Supplemental Information. Spatial Auxin Signaling. Controls Leaf Flattening in Arabidopsis
|
|
- Brianne Harrington
- 6 years ago
- Views:
Transcription
1 Current Biology, Volume 27 Supplemental Information Spatial Auxin Signaling Controls Leaf Flattening in Arabidopsis Chunmei Guan, Binbin Wu, Ting Yu, Qingqing Wang, Naden T. Krogan, Xigang Liu, and Yuling Jiao
2 Figure S1. Different markers expressed in young leaf primordia. Related to Figure 1. (A) P2 and P3 leaf primordia of Arabidopsis. S, stipule. Scale bar, 50 m. (B) Expression patterns of ARF6, ARF7, ARF8 and ARF19 in the leaf primordia. Transverse sections through parf6::n3gfp, pnph4::n3gfp, parf8::n3gfp, and parf19::n3gfp SAM and leaf primordia region. GFP signals are shown in green and PI staining in red. Scale bars, 20 m. (C) Expression patterns of MP, DR5, and DII in the leaf primordia. Longitudinal and transverse sections through pmp::mp-gfp, pdr5::gfper, and p35s::dii-venus SAM and leaf primordia region. GFP and venus signals are shown in green. Scale bars, 20 m. (D) Optical section analysis of young leaf primordia expressing pdr5v2::ntdtomato and pdr5::n3gfp. DR5, green. DR5v2, magenta. Purple dotted lines indicate transverse sections. Scale bars, 20 m.
3 Figure S2. Dof5.8 expression level and seedling phenotypes of pmp::mp -EAR-GR transgenic plants. Related to Figure 2. (A) Dof5.8 expression under Dex treatment in pmp::mp -EAR-GR transgenic plants. Data are presented as mean ± SD for more than three independent experiments. *P < (B) Phenotypes of pmp::mp -EAR-GR transgenic plants under 10 m Dex treatment at different developmental stages. Scale bars, 1 mm and 10 mm for the upper and lower panels, respectively.
4 Figure S3. Auxin induces WOX1 expression and the overexpression of MP promotes WOX1 adaxial expression. Related to Figure 3. (A) SlWOX1 expression 24 h after IAA treatment in tomato P 1 leaf primordia. Data are presented as mean ± SD for more than three independent experiments. *P < (B) Serial sections of pmp::mp leaf primordia in ISH analysis of WOX1 expression pattern. P 4 in the right section is comparable to P 4 of Col-0 in (A) along the proximodistal axis. Ladders colored in yellow indicate cells with WOX1 transcripts. Scale bars, 20 m.
5 Figure S4. Seedling phenotype of pwox1::wox1 and pwox1 ::WOX1 transgenic plants in wox1-2 prs double mutant background. Related to Figure 4. Scale bars, 1 mm for 9 d and 12 d, and 10 mm for 30 d.
6 Figure S5. WOX1 and PRS expression pattern in arf3-1 arf4-2 and arf2-6 arf3-1 arf4-2 mutants and the seedling phenotypes of the triple mutants. Related to Figure 5. (A) Serial sections of arf3-1 arf4-2 leaf primordia in ISH analysis of WOX1 expression pattern. M, meristem. Scale bars, 20 m. (B) Seedling phenotypes of arf3-1 arf4-2 double and arf2-6 arf3-1 arf4-2 triple mutants. White arrows indicate typical rosette leaves with different phenotypes in double and triple mutants respectively. Scale bars, 1 mm for 9 d, and 10 mm for others. (C) A trumpet-like leaf of arf2-6 arf3-1 arf4-2 triple mutant. Scale bar, 1 mm.
7 Figure S6. Phenotypes of p35s::amir-arf transgenic plants. Related to Figure 5. (A) Vegetative phenotypes of p35s::amir-arf plants. Scale bar, 10 mm. (B) Leaf abaxial side phenotypes of wild-type and p35s::amir-arf rosette leaves. Scale bar, 1 mm. (C) RT-qPCR analysis of ARF2, ARF3, and ARF4 expression levels in p35s::amir-arf rosette leaves.
8 Table S1. Primers used for RT-PCR, ChIP-PCR and Y1H. Related to STAR Methods. Primer Primer sequence (5-3 ) WOX1-RT-F WOX1-RT-R PRS-RT-F PRS-RT-R ARF2-RT-F ARF2-RT-R ARF3-RT-F ARF3-RT-R ARF4-RT-F ARF4-RT-R MP-RT-F MP-RT-R ACTIN2F ACTIN2R WOX1-1-ChIP-F WOX1-1-ChIP-R WOX1-2-ChIP-F WOX1-2-ChIP-R WOX1-3-ChIP-F WOX1-3-ChIP-R WOX1-4-ChIP-F WOX1-4-ChIP-R PRS-1-ChIP-F PRS-1-ChIP-R PRS-2-ChIP-F PRS-2-ChIP-R PRS-3-ChIP-F PRS-3-ChIP-R PRS-4-ChIP-F PRS-4-ChIP-R WOX1-1-Y1H-F WOX1-1-Y1H-R WOX1-2-Y1H-F WOX1-2-Y1H-R WOX1-3-Y1H-F WOX1-3-Y1H-R WOX1-4-Y1H-F WOX1-4-Y1H-R PRS-1-Y1H-F PRS-1-Y1H-R CTGGATATGTTCGGTCGGATG CTCCACCCGTATATTCGCTG TGTCCTTTGATTGCTGCTCTC TCTTCAGCTCCACTTTTGGTGCAG GCGAGTTCGGAGGTTTCAATGAAA TCTGTAAAGAGCAGCCTCAGGGTCC CGCCTACTCAATAACCGATCATC ACGGCCCACACCAAATGTT CGCTTAAATCATTCCCGCAAT ACTTGTTGGCTTGGTAAGCAAAG GTTGAAAGACCAGTCAGGTAC ATGTCTCTTTGGTTGCCCTC GAGAGGTTACATGTTCACCACAAC GTGAACGATTCCTGGACCTGCCTC CTGAGCTCGACAGAAAAGGGGGATTTAA GACTCGAGCATTCCTCCCATCTCTCCCC GCTGATCACTGCATTTATTG GTCTCGAGCCCAACCAAATATATGTCAC CCCATAAGCCAAAATAGCCA GGAGAAGGGAGAGAGACAGCG CTGAGCTCCGAGAACGCCAGAAACGACG CACTCGAGCTCTGGTTGCGTGTCGCATC GATTATTTCTAGAAGAGGAC AGAATCTCCAGAAACTGAGC CAGACAATTCTATGCCTGAT CTTTACATGGACAGACAAGC GTTAATGAGTACTGGCGTTT GGAGAGAAAGAGAAAAGGAAC CTCTTGCGTCCCTTTCCAAT AGGACTCATTCTCCGTTCAGAC CTGAGCTCGACAGAAAAGGGGGATTTAA GACTCGAGCATTCCTCCCATCTCTCCCC GAGAGCTCTCACGTCGTTATAAGCTCCT GTCTCGAGCCCAACCAAATATATGTCAC GAGAGCTCGGTATCTCTTTCTCTCTCTC CACTCGAGGGCTTTGTGGTTTTGGAACC CTGAGCTCCGAGAACGCCAGAAACGACG CACTCGAGCTCTGGTTGCGTGTCGCATC CGGAGCTCGATTATTTCTAGAAGAGGAC CGGTCGACAGAATCTCCAGAAACTGAGC
9 PRS-2-Y1H-F PRS-2-Y1H-R PRS-3-Y1H-F PRS-3-Y1H-R PRS-4-Y1H-F PRS-4-Y1H-R ARF4-Y1H-F ARF4-Y1H-R GCGAGCTCCAGACAATTCTATGCCTGAT GCGTCGACCTTTACATGGACAGACAAGC GCGAGCTCGTTAATGAGTACTGGCGTTT GCGTCGACGGAGAGAAAGAGAAAAGGAAC GCGAGCTCCTCTTGCGTCCCTTTCCAAT GCGTCGACAGGACTCATTCTCCGTTCAGAC AAAGCGGCCGCCATGGAATTTGACTTGAATAC TTGGCGCGCCAACCCTAGTGATTGTAGGAG
Supplemental Data. Müller-Xing et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Phenotypes of iclf (clf-28 swn-7 CLF pro :CLF-GR) plants. A, Late rescue of iclf plants by renewed DEX treatment; senescent inflorescence with elongated siliques (arrow; 90 DAG,
More informationSupplemental Figure S1. The number of hydathodes is reduced in the as2-1 rev-1
Supplemental Data Supplemental Figure S1. The number of hydathodes is reduced in the as2-1 rev-1 and kan1-11 kan2-5 double mutants. A, The numbers of hydathodes in different leaves of Col-0, as2-1 rev-1,
More informationTesting the ABC floral-organ identity model: expression of A and C function genes
Objectives: Testing the ABC floral-organ identity model: expression of A and C function genes To test the validity of the ABC model for floral organ identity we will: 1. Use the model to make predictions
More informationSupplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
More informationSupplemental Data. Wang et al. (2013). Plant Cell /tpc
Supplemental Data. Wang et al. (2013). Plant Cell 10.1105/tpc.112.108993 Supplemental Figure 1. 3-MA Treatment Reduces the Growth of Seedlings. Two-week-old Nicotiana benthamiana seedlings germinated on
More informationSupplemental Data. Wu et al. (2010). Plant Cell /tpc
Supplemental Figure 1. FIM5 is preferentially expressed in stamen and mature pollen. The expression data of FIM5 was extracted from Arabidopsis efp browser (http://www.bar.utoronto.ca/efp/development/),
More informationSupplemental Data. Beck et al. (2010). Plant Cell /tpc
Supplemental Figure 1. Phenotypic comparison of the rosette leaves of four-week-old mpk4 and Col-0 plants. A mpk4 vs Col-0 plants grown in soil. Note the extreme dwarfism of the mpk4 plants (white arrows)
More informationOpen Flower. Juvenile leaf Flowerbud. Carpel 35 NA NA NA NA 61 NA 95 NA NA 15 NA 41 3 NA
PaxDB Root Juvenile leaf Flowerbud Open Flower Carpel Mature Pollen Silique Seed Sec3a Sec3b Sec5a Sec5b Sec6 Sec8 Sec10a/b Sec15a Sec15b Exo84a Exo84b Exo84c Exo70A1 Exo70A2 Exo70A3 49 47 8 75 104 79
More informationSupplementary Figures
Supplementary Figures 9 10 11 Supplementary Figure 1. Old plants are more resistant to insect herbivores than young plants. (a) Image of young (1-day-old, 1D) and old (-day-old, D) plants of Arabidopsis
More informationFILAMENTOUS FLOWER Controls the Formation and Development of Arabidopsis Inflorescences and Floral Meristems
The Plant Cell, Vol. 11, 69 86, January 1999, www.plantcell.org 1999 American Society of Plant Physiologists FILAMENTOUS FLOWER Controls the Formation and Development of Arabidopsis Inflorescences and
More informationSupplemental Data. Hiruma et al. Plant Cell. (2010) /tpc Col-0. pen2-1
A Ch B Col-0 Cg pen2-1 Supplemental Figure 1. Trypan Blue Staining of Leaves Inoculated with Adapted and Nonadapted Colletotrichum Species.(A) Conidial suspensions of C. higginsianum MAFF305635 (Ch) were
More informationSupplementary Figures
Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion
More informationSupplemental Figure S1. Sequence feature and phylogenetic analysis of GmZF351. (A) Amino acid sequence alignment of GmZF351, AtTZF1, SOMNUS, AtTZF5,
Supplemental Figure S. Sequence feature and phylogenetic analysis of GmZF35. (A) Amino acid sequence alignment of GmZF35, AtTZF, SOMNUS, AtTZF5, and OsTZF. Characters with black background indicate conserved
More informationSupplemental Information. Figures. Figure S1
Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the
More informationSupplemental data. Uppalapati et al. (2012) Plant Cell /tpc
PAL Control P. emaculata 0 8 24 48 8 24 48 OPR Control P. emaculata 0 8 24 48 8 24 48 CHS PR3 CHR PR5 CHI PR10 IFS IFR Supplemental Figure 1. Expression profiles for selected genes in phenylpropanoid pathway
More informationSupporting Information
Supporting Information Lee et al. 10.1073/pnas.0910950106 Fig. S1. Fe (A), Zn (B), Cu (C), and Mn (D) concentrations in flag leaves from WT, osnas3-1, and OsNAS3-antisense (AN-2) plants. Each measurement
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationARGONAUTE10 and ARGONAUTE1 Regulate the Termination of Floral Stem Cells Through Two MicroRNAs in Arabidopsis
University of Kentucky UKnowledge Plant and Soil Sciences Faculty Publications Plant and Soil Sciences 3-31-2011 ARGONAUTE10 and ARGONAUTE1 Regulate the Termination of Floral Stem Cells Through Two MicroRNAs
More informationTable S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples.
Supplementary files Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples. Table S3. Specificity of AGO1- and AGO4-preferred 24-nt
More informationFigure legends of supplementary figures
Figure legends of supplementary figures Figure 1. Phenotypic analysis of rice early flowering1 () plants and enhanced expression of floral identity genes in.. Leaf emergence of,, and plants with complementary
More informationArabidopsis: Flower Development and Patterning
Arabidopsis: Flower Development and Patterning John L Bowman, University of California, Davis, California, USA The development of flowers and floral organs is directed by genetic programmes likely to be
More informationSupplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
More informationMacrophages form functional vascular mimicry channels in vivo. SI Figures and Legend
Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin
More informationLight triggers PILS-dependent reduction in nuclear auxin signalling for growth transition
In the format provided y the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: 217.15 Light triggers PILS-dependent reduction in nuclear auxin signalling for growth transition Chloé
More informationSupplemental Data. Hao et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Confocal Images and VA-TIRFM Analysis of GFP-RbohD in Arabidopsis Seedlings. (A) RbohD expression in whole Arabidopsis seedlings. RbohD was expressed in the leaves, hypocotyl, and
More informationSupplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
More informationPatterns of Cell Division, Cell Differentiation and Cell Elongation in Epidermis and Cortex of Arabidopsis pedicels in the Wild Type and in erecta
Patterns of Cell Division, Cell Differentiation and Cell Elongation in Epidermis and Cortex of Arabidopsis pedicels in the Wild Type and in erecta Mark G. R. Bundy, Olivia A. Thompson, Matthew T. Sieger,
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/329/5997/1306/dc1 Supporting Online Material for Oscillating Gene Expression Determines Competence for Periodic Arabidopsis Root Branching Miguel A. Moreno-Risueno,
More informationGenetic Specification of floral organ identity. Initiating floral development. Deciding when to initiate flowering - induced mutations -in Nature
Genetic Specification of floral organ identity Initiating floral development Deciding when to initiate flowering - induced mutations -in Nature Flower structure of rabidopsis Stamens arpels Petals Sepals
More informationFig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between
Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between Myod +/ or Myod / females and Myod +/ ;Igf2 +/ males and
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationTable S1. Total and mapped reads produced for each ChIP-seq sample
Tale S1. Total and mapped reads produced for each ChIP-seq sample Sample Total Reads Mapped Reads Col- H3K27me3 rep1 125662 1334323 (85.76%) Col- H3K27me3 rep2 9176437 7986731 (87.4%) atmi1a//c H3K27m3
More informationThe NGATHA Genes Direct Style Development in the Arabidopsis Gynoecium C W
The Plant Cell, Vol. 21: 1394 1409, May 2009, www.plantcell.org ã 2009 American Society of Plant Biologists The NGATHA Genes Direct Style Development in the Arabidopsis Gynoecium C W Marina Trigueros,
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationSupplemental Data. Jones et al. (2012). Plant Cell /tpc
Supplemental Data. Jones et al. (). Plant Cell.5/tpc..88 Relative ioluminescence C Relative ioluminescence E Relative ioluminescence 8 7 96 8 7 96 STIPL:STIPL-GFP 8 7 96 Relative ioluminescence Relative
More informationSpecification of Arabidopsis floral meristem identity by repression of flowering time genes
RESEARCH ARTICLE 1901 Development 134, 1901-1910 (2007) doi:10.1242/dev.003103 Specification of Arabidopsis floral meristem identity by repression of flowering time genes Chang Liu 1, *, Jing Zhou 1, *,
More informationddm1a (PFG_3A-51065) ATG ddm1b (PFG_2B-60109) ATG osdrm2 (PFG_3A-04110) osdrm2 osdrm2 osdrm2
Relative expression.6.5.4.3.2.1 OsDDM1a OsDDM1b OsDRM2 TG TG TG ddm1a (PFG_3-5165) P1 P3 ddm1b (PFG_2-619) P2 531bp 5233bp P1 P4 P3 P2 F1 R1 F1 TG TG TG F1 R1 C ddm1a -/- -/- ddm1b -/- +/- +/- -/- D (PFG_3-411)
More informationHANABA TARANU Is a GATA Transcription Factor That Regulates Shoot Apical Meristem and Flower Development in Arabidopsis W
The Plant Cell, Vol. 16, 2586 2600, October 2004, www.plantcell.org ª 2004 American Society of Plant Biologists HANABA TARANU Is a GATA Transcription Factor That Regulates Shoot Apical Meristem and Flower
More informationMolecular mechanism of the priming by jasmonic acid of specific dehydration stress response genes in Arabidopsis
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications in the Biological Sciences Papers in the Biological Sciences 2016 Molecular mechanism of the priming
More informationEctopic Expression of atrsz33 Reveals Its Function in Splicing and Causes Pleiotropic Changes in Development
Molecular Biology of the Cell Vol. 14, 3565 3577, September 2003 Ectopic Expression of atrsz33 Reveals Its Function in Splicing and Causes Pleiotropic Changes in Development Maria Kalyna, Sergiy Lopato,*
More informationSupplemental Data. Candat et al. Plant Cell (2014) /tpc Cytosol. Nucleus. Mitochondria. Plastid. Peroxisome. Endomembrane system
Cytosol Nucleus 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 PSORT MultiLoc YLoc SubLoc BaCelLo WoLF PSORT
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationWT siz1-2 siz1-3. WT siz1-2 siz1-3. -Pi, 0.05 M IAA. -Pi, 2.5 M NPA
A WT siz1-2 siz1-3 B WT siz1-2 siz1-3 -Pi C +Pi WT siz1-2 siz1-3 D WT siz1-2 siz1-3 E +Pi, 0.05 M IAA -Pi, 0.05 M IAA WT siz1-2 siz1-3 WT siz1-2 siz1-3 F +Pi, 2.5 M NPA -Pi, 2.5 M NPA Supplemental Figure
More informationGenome-Wide Analysis of leafbladeless1-regulated and Phased Small RNAs Underscores the Importance of the TAS3 ta-sirna Pathway to Maize Development
Genome-Wide Analysis of leafbladeless1-regulated and Phased Small RNAs Underscores the Importance of the TAS3 ta-sirna Pathway to Maize Development Marcela C. Dotto 1, Katherine A. Petsch 1, Milo J. Aukerman
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationA Bacterial Virulence Protein Suppresses Host Innate Immunity to Cause Plant Disease
A Bacterial Virulence Protein Suppresses Host Innate Immunity to Cause Plant Disease Nomura, K., Debroy, S., Lee, Y.H., Pumplin, N., Jones, J., and He, S.Y. (2006). Science 313, 220-223. Presented by:
More informationThe SEP4 Gene of Arabidopsis thaliana Functions in Floral Organ and Meristem Identity
Current Biology, Vol. 14, 1935 1940, November 9, 2004, 2004 Elsevier Ltd. All rights reserved. DOI 10.1016/j.cub.2004.10.028 The SEP4 Gene of Arabidopsis thaliana Functions in Floral Organ and Meristem
More informationFig. S1. RT-PCR analyses of the expression and distribution of Xdscr6 transcripts during early development.
Fig. S1. RT-PCR analyses of the expression and distribution of Xdscr6 transcripts during early development. (A) Temporal expression of Xdscr6 at various stages (numbers on the top) and its distribution
More informationAsymmetric leaf development and blade expansion in Arabidopsis are mediated by KANADI and YABBY activities
Research article 2997 Asymmetric leaf development and blade expansion in Arabidopsis are mediated by KANADI and YABBY activities Yuval Eshed 1,2, *,, Anat Izhaki 1, *, Stuart F. Baum 1,, Sandra K. Floyd
More informationRegulation of Floral Organ Identity. Dr. Chloe Diamond Mara
Regulation of Floral Organ Identity Dr. Chloe Diamond Mara Flower Development Angiosperms (flowering plants) are the most widespread group of land plants Flowers are the reproductive organs that consist
More informationWidespread Long Noncoding RNAs as Endogenous Target Mimics for MicroRNAs in Plants 1[W]
Widespread Long Noncoding RNAs as Endogenous Target Mimics for MicroRNAs in Plants 1[W] Hua-Jun Wu 2, Zhi-Min Wang 2, Meng Wang, and Xiu-Jie Wang* State Key Laboratory of Plant Genomics, Institute of Genetics
More informationSUPPLEMENTARY INFORMATION
Supplementary Information included with Nature MS 2008-02-01484B by Colantonio et al., entitled The dynein regulatory complex is required for ciliary motility and otolith biogenesis in the inner ear. This
More informationUFO and LEAFY in Arabidopsis
Development 128, 2735-2746 (2001) Printed in Great Britain The Company of Biologists Limited 2001 DEV0360 2735 The ASK1 gene regulates B function gene expression in cooperation with UFO and LEAFY in Arabidopsis
More informationSUPPLEMENTARY FIGURE S1: nlp-22 is expressed in the RIA interneurons and is secreted. (a) An animal expressing both the RIA specific reporter
1 SUPPLEMENTARY FIGURE S1: nlp-22 is expressed in the RIA interneurons and is secreted. (a) An animal expressing both the RIA specific reporter Pglr-3:mCherry (red) and Pnlp-22:gfp (green) shows co-localization
More informationSupporting Information for
Supporting Information for CuO Nanoparticle Interaction with Arabidopsis: Toxicity, Parent-Progeny Transfer and Gene Expression Zhenyu Wang,, Lina Xu, Jian Zhao,,, Xiangke Wang, Jason C. White, and Baoshan
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationFigure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from
Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from germ cell mutants (dnrar flox/flox, Stra8-Cre +, RARElacZ) (A ), controls (dnrar flox/flox, RARElacZ) (B ),
More informationThe N-end rule pathway regulates pathogen responses. in plants
SUPPLEMENTARY INFORMATION The N-end rule pathway regulates pathogen responses in plants Rémi de Marchi 1,2, Maud Sorel 1, Brian Mooney 1, Isabelle Fudal 3, Kevin Goslin 1, Kamila Kwaśniewska 4, Patrick
More informationTitle: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease
1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak
More informationA putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus
Supplementary figures for: A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus officinalis Daisuke Tsugama, Kohei Matsuyama, Mayui Ide, Masato Hayashi, Kaien Fujino, and
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More informationCell-FateSwitchofSynergidtoEggCellinArabidopsis eostre Mutant Embryo Sacs Arises from Misexpression of the BEL1-Like Homeodomain Gene BLH1 W
The Plant Cell, Vol. 19: 3578 3592, November 2007, www.plantcell.org ª 2007 American Society of Plant Biologists Cell-FateSwitchofSynergidtoEggCellinArabidopsis eostre Mutant Embryo Sacs Arises from Misexpression
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites.
Supplementary Figure 1 Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites. Staining with fluorescence antibodies to detect GFP (Green), β-galactosidase (magenta/white). (a, b) Class
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More informationThe Arabidopsis homeotic genes APETALA3 and PISTILLATA are sufficient to provide the B class organ identity function
University of South Carolina Scholar Commons Faculty Publications Biological Sciences, Department of 1-1-1996 The Arabidopsis homeotic genes APETALA3 and PISTILLATA are sufficient to provide the B class
More informationSupplementary Figure 1
Supplementary Figure 1 5 microns C7 B6 unclassified H19 C7 signal H19 guide signal H19 B6 signal C7 SNP spots H19 RNA spots B6 SNP spots colocalization H19 RNA classification Supplementary Figure 1. Allele-specific
More informationOverexpression of the brassinosteroid biosynthetic gene DWF4 in Brassica napus simultaneously increases seed yield and stress tolerance
Overexpression of the brassinosteroid biosynthetic gene DWF4 in Brassica napus simultaneously increases seed yield and stress tolerance Authors Sangita Sahni 1+, Bishun D. Prasad 1+, Qing Liu 2, Vojislava
More informationSupplementary Figure 1 Madm is not required in GSCs and hub cells. (a,b) Act-Gal4-UAS-GFP (a), Act-Gal4-UAS- GFP.nls (b,c) is ubiquitously expressed
Supplementary Figure 1 Madm is not required in GSCs and hub cells. (a,b) Act-Gal4-UAS-GFP (a), Act-Gal4-UAS- GFP.nls (b,c) is ubiquitously expressed in the testes. The testes were immunostained with GFP
More informationSupplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were
Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were electroporated with β- Catenin S33Y in PiggyBac expression
More informationA basic helix loop helix transcription factor controls cell growth
A basic helix loop helix transcription factor controls cell growth and size in root hairs Keke Yi 1,2, Benoît Menand 1,3, Elizabeth Bell 1, Liam Dolan 1,4 Supplementary note Low soil phosphate availability
More informationArabidopsis PRC1 core component AtRING1 regulates stem cell-determining carpel development mainly through repression of class I KNOX genes
Chen et al. BMC Biology (2016) 14:112 DOI 10.1186/s12915-016-0336-4 RESEARCH ARTICLE Open Access Arabidopsis PRC1 core component AtRING1 regulates stem cell-determining carpel development mainly through
More informationNature Genetics: doi: /ng Supplementary Figure 1. Parameters and consequences of mononuclear cardiomyocyte frequency.
Supplementary Figure 1 Parameters and consequences of mononuclear cardiomyocyte frequency. (a) Correlation of the frequency of mononuclear cardiomyocytes to the frequency of cardiomyocytes with three or
More informationSupplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
More informationCloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation. Sarah J. MacDonald Assistant Professor Missouri Valley College
Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation Sarah J. MacDonald Assistant Professor Missouri Valley College Phytoremediation of Organic Compounds Phytodegradation: Plants
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
More informationCHAPTER 5 RESULTS Previous study: cell culture and organotypical slices
45 CHAPTER 5 RESULTS 5.1. Previous study: cell culture and organotypical slices Initial experiments have been conducted to ensure that the tet-on system works. A neuronal cell culture from mice expressing
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationCLAVATA3 is a specific regulator of shoot and floral meristem development
Development 2, 20572067 (995) Printed in Great Britain The Company of Biologists Limited 995 2057 CLAVATA3 is a specific regulator of shoot and floral meristem development affecting the same processes
More informationDirect Interaction of Ligand-Receptor Pairs Specifying Stomatal Patterning
Lee_Jin Suk 1 Direct Interaction of Ligand-Receptor Pairs Specifying Stomatal Patterning Jin Suk Lee, Takeshi Kuroha, Marketa Hnilova, Dmitriy Khatayevich, Masahiro M. Kanaoka, Jessica M. McAbee, Mehmet
More informationInfluenza virus exploits tunneling nanotubes for cell-to-cell spread
Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,
More informationMG132. GRXS17:V5-His MG132 GRXS17:HA. RuBisCo. Supplemental Data. Walton et al. (2015). Plant Cell /tpc
MG132 GRXS17:V5-His MG132 GRXS17:HA RuBisCo Supplemental Figure 1. Degradation of GRXS17 by the 26S proteasome. (A) Cell-free degradation assay. Recombinant protein GRXS17:V5-HIS was incubated with total
More informationRegulation of Floral-Organ- Type by SUPERMAN
Regulation of Floral-Organ- Type by SUPERMAN 1. Need for regulators of the organ-identity genes. 2. The Superman mutant phenotype-predicting the role of SUPERMAN. 3. Testing our hypothesis of the role
More informationSupplemental Data. Deinlein et al. Plant Cell. (2012) /tpc
µm Zn 2+ 15 µm Zn 2+ Growth (% of control) empty vector NS1 NS2 NS3 NS4 S. pombe zhfδ Supplemental Figure 1. Functional characterization of. halleri NS genes in Zn 2+ hypersensitive S. pombe Δzhf mutant
More informationeffects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no
Supplementary Figure 1. Loss of function clones of 14-3-3 or 14-3-3 show no significant effects on organ development. a-f, Eye and wing discs with clones of 14-3-3ε j2b10 show no obvious defects in Elav
More informationSupplemental Figure S1.
53 kda- WT TPS29.2 (ethanol) TPS29.2 (water) Supplemental Figure S1. Inducible expression of E. coli otsa (TPS) in Arabidopsis. Immunoblot of leaf proteins (20 µg per lane) extracted from: (i) WT Col-0,
More informationKingdom Accepted author version posted online: 29 Apr 2015.
This article was downloaded by: [Universitaets und Landesbibliothek] On: 06 May 2015, At: 11:50 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered
More informationSupplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and
More informationGenome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice
Supplementary Information Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Gou Takahashi, Channabasavaiah B Gurumurthy,
More informationRibosomal proteins promote leaf adaxial identity
RESEARCH ARTICLE 1325 Development 135, 1325-1334 (2008) doi:10.1242/dev.017913 Ribosomal proteins promote leaf adaxial identity Yao Yao*, Qihua Ling*, Hua Wang and Hai Huang Establishing abaxial-adaxial
More informationsirna count per 50 kb small RNAs matching the direct strand Repeat length (bp) per 50 kb repeats in the chromosome
Qi et al. 26-3-2564C Qi et al., Figure S1 sirna count per 5 kb small RNAs matching the direct strand sirna count per 5 kb small RNAs matching the complementary strand Repeat length (bp) per 5 kb repeats
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
More information