PGC-1a Coordinates Mitochondrial Respiratory Capacity and Muscular Fatty Acid Uptake via Regulation of VEGF-B

Transcription

1 Diabetes Volume 65, April Annika Mehlem, Isolde Palombo, Xun Wang, Carolina E. Hagberg, Ulf Eriksson, and Annelie Falkevall PGC-1a Coordinates Mitochondrial Respiratory Capacity and Muscular Fatty Acid Uptake via Regulation of VEGF-B Diabetes 2016;65: DOI: /db Vascular endothelial growth factor (VEGF) B belongs to the VEGF family, but in contrast to VEGF-A, VEGF-B does not regulate blood vessel growth. Instead, VEGF-B controls endothelial fatty acid (FA) uptake and was identified as a target for the treatment of type 2 diabetes. The regulatory mechanisms controlling Vegfb expression have remained unidentified. We show that peroxisome proliferator activated receptor g coactivator 1a (PGC-1a) together with estrogen-related receptor a (ERR-a) regulates expression of Vegfb. Mice overexpressing PGC-1a under the muscle creatine kinase promoter (MPGC-1aTG mice) displayed increased Vegfb expression, and this was accompanied by increased muscular lipid accumulation. Ablation of Vegfb in MPGC-1aTG mice fed a highfat diet (HFD) normalized glucose intolerance, insulin resistance, and dyslipidemia. We suggest that VEGF-B is the missing link between PGC-1a overexpression and the development of the diabetes-like phenotype in HFD-fed MPGC-1aTG mice. The findings identify Vegfb as a novel gene regulated by the PGC-1a/ERR-a signaling pathway. Furthermore, the study highlights the role of PGC-1a as a master metabolic sensor that by regulating the expression levels of Vegfa and Vegfb coordinates blood vessel growth and FA uptake with mitochondrial FA oxidation. Vascular endothelial growth factor B (VEGF-B) has been shown to control endothelial fatty acid (FA) transcytosis and tissue accumulation of lipids through regulation of the FA transport proteins (FATPs) FATP3 and FATP4 (1). Reduction of VEGF-B levels improves the development of type 2 diabetes in diabetic rodent models by decreasing muscular lipid accumulation (2). However, the regulation of Vegfb expression is not well understood. Vegfb expression is high in mitochondria-dense tissues (3), and bioinformatic analysis showed that Vegfb is coexpressed with a set of nuclear-encoded mitochondrial genes, the so-called OXPHOS genes (1). Peroxisome proliferator activated receptor g coactivator 1a (Ppargc1a/ PGC-1a) is a major regulator of mitochondrial energy metabolism, and in response to extrinsic factors, PGC-1a binds to and coactivates several transcription factors, including estrogen-related receptor a (Esrra/ERR-a), peroxisome proliferator activated receptor g (PPARg), and nuclear respiratory factor 1 (NRF1) (4). A common pathology in type 2 diabetes is dysfunctional and insufficient muscular mitochondria content (5), and therefore, elevated PGC-1a expression was expected to be beneficial by inducing mitochondrial biogenesis. Of note, mice overexpressing PGC-1a in skeletal muscle (muscle creatine kinase PGC-1a transgenic [MPGC-1aTG] mice) displayed reduced insulin sensitivity upon high-fat diet (HFD) feeding despite increased mitochondrial density and higher respiratory capacity (6,7). Given the coexpression of Vegfb with OXPHOS genes and the role of VEGF-B in ectopic lipid accumulation and insulin resistance, we stipulated that Vegfb expression may be regulated by PGC-1a as well.in the current study,we show that PGC-1a and ERR-a control the expression of Vegfb. This METABOLISM Department of Medical Biochemistry and Biophysics, Division of Vascular Biology, Karolinska Institutet, Stockholm, Sweden Corresponding authors: Annelie Falkevall, annelie.falkevall@ki.se, and Ulf Eriksson, ulf.pe.eriksson@ki.se. Received 2 September 2015 and accepted 4 January This article contains Supplementary Data online at U.E. and A.F. were equal senior authors. C.E.H. is currently affiliated with the Department of Cell and Molecular Biology, Karolinska Institutet, Stockholm, Sweden by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

2 Table 1 Primer sequences a Fwd primer Rev primer 862 PGC-1a Regulates Vegfb Expression Diabetes Volume 65, April 2016 Vegfb TCTGAGCATGGAACTCATGG TCTGCATTCACATTGGCTGT Ndufa5 ATCACCTTCGAGAAGCTGGA ACTTCACCACCCTGAAGCAA Cycs CCAAATCTCCACGGTCTGTT CCAGGTGATGCCTTTGTTCT Vegfa CAGGCTGCTGTAACGATGAA TATGTGCTGGCTTTGGTGAT L19 GGTGACCTGGATGAGAAGGA TTCAGCTTGTGGATGTGCTC B2m CTGACCGGCCTGTATGCTAT CCGTTCTTCAGCATTTGGAT Slc2a4 ACTCTTGCCACACAGGCTCT CCTTGCCCTGTCAGGTATGT Fatp1 TCAATGTACCAGGAATTACAGAAGG GAGTGAGAAGTCGCCTGCAC Fatp3 CGCAGGCTCTGAACCTGG TCGAAGGTCTCCAGACAGGAG Fatp4 GCAAGTCCCATCAGCAACTG GGGGGAAATCACAGCTTCTC Cd36 GATGAGCATAGGACATACTTAGATGTG CACCACTCCAATCCCAAGTAAG Tfam CCTGAGGAAAAGCAGGCATA ATGTCTCCGGATCGTTTCAC Esrra TGGCCTCTGGCTACCACTAC CGCTTGGTGATCTCACACTC Ppargc1a GACATGTGCAGCCAAGACTC TCAGGAAGATCTGGGCAAAG Ndufb10 TGGAGCAGTTCACCAAAGTG TTCCAGCATTCTCTGCTTCT Slc2a1 GCTGTGCTTATGGGCTTCTC CACATACATGGGCACAAAGC Acox1 CACTGCCACATATGACCCCAA AGAGGCTTGTGGGTCCAA Acadm TGCCTGTGATTCTTGCTGGAA CTTTCCCCCGTTGGTTATCCA Acadvl CGACACTTTGCAGGGACTCA GGCCTTTGTGCCATAGAGCA Hk2 CTTGCTGAAGGAAGCCATTCG CCGTCCACCAGTTCCACATTA Pdk4 GGCTTGCCAATTTCTCGTCTC CACCAGTCATCAGCTTCGGA Cs AGCCCTCAACAGTGAAAGCA TCAATGGCTCCGATACTGCTG Plpp1 CAGTCCTTGACTGACATCGCTAA GAGAATGAAGAGTGTCCCGAGT Sptlc1 ATCAGCGGCTCTCCGGTCAA AAGCGCCGGAGAAAGGGACT Cers2 GGGCGCTAGAAGTGGGAAA GCTTTGGCATAGACACGTCC Atgl GCCAACGCCACTCACATCTA CGGATGGTCTTCACCAGGTT Acadm, acyl-coa dehydrogenase, medium chain; Acadvl, acyl-coa dehydrogenase, very long chain; Acox1, acyl-coa oxidase 1; B2m, b-2-microglobulin; Cers2, ceramide synthase 2; Cs, citrate synthase; Hk2, hexokinase 2; Slc2a1, solute carrier family 2 (facilitated glucose transporter), member 1; Slc2a4, solute carrier family 2 (facilitated glucose transporter), member 4; Sptlc1, serine palmitoyltransferase, long chain base subunit 1. a All sequences are written previously undescribed regulatory pathway allows PGC-1a to coordinate FA uptake with mitochondrial FA oxidation through regulation of VEGF-B levels. RESEARCH DESIGN AND METHODS Animal Handling MPGC-1aTG mice (6) were crossed with Vegfb-deficient mice (3) to ultimately create MPGC-1aTG//Vegfb 2/2 mice, and only male age-matched mice from the F3 generation were used. For HFD studies, wild-type (WT), MPGC-1aTG, MPGC-1aTG//Vegfb 2/2, and Vegfb 2/2 mice where fed 60% HFD (Research Diets) for 12 weeks starting from 5 weeks of age. The study was repeated twice. All animals had ad libitum access to food and water and were housed in standard cages in anenvironmentwith12-hlight/darkcycles.allmouse work was conducted in accordance to the Swedish Animal Welfare Board at Karolinska Institutet, Stockholm, Sweden. Cell Culture Cell lines were maintained in DMEM supplemented with 10% FBS at 37 C in 5% CO 2. C2C12 was maintained as described (8). For nutrient deprivation studies, cells were starved in DMEM. Bioinformatic Analysis Putative consensus binding sites for ERR-a (ERR1_Q2) within the first kilobase (kb) promoter and first intron of Vegfb were analyzed using Evolutionary Conserved Region (ECR) Browser, Mulan, and multitf databases (9) ( ecrbrowser.dcode.org). The sequences within the ECRs were fed to Mulan and then continued with multitf analysis with a predefined factor of Cloning and Mutagenesis The plasmids pcmx-err-a, pcdna3.1/myc-hisa-pgc- 1a-FLAG, ptk-luc, and pcmx-b-gal and corresponding empty vectors were used in the experiments. PCR fragments of the first kb Vegfb promoter and first Vegfb intron were

3 diabetes.diabetesjournals.org Mehlem and Associates 863 generated with overhangs of Hind III and Sbf I restriction cleavage sites and 12 more random base pairs (bps). The fragments were digested with Hind III and Sbf I and then subcloned into ptk-luc. Putative ERR-a binding sites were mutated into Nco I restriction cleavage site (CCATGG) by site-directed mutagenesis. Transient Transfection and Luciferase Assay COS-1 cells were transfected in 24-well plates using Lipofectamine LTX according to the manufacturer s instructions. pcmx-b-gal was cotransfected to allow normalization of transfection efficiency, and 24 or 48 h posttransfection, the cells were harvested and lysed. OD 405 for b-galactosidase activity and chemiluminescence signal for luciferase activity were read by using a POLARstar Omega plate reader. RNA Extraction and Real-Time Quantitative PCR PGC-1a overexpression in the MPGC-1aTG mice is highest in glycolytic type II fibers (6); therefore, quadriceps femoris was used for all downstream analyses. Total RNA was extracted by using the RNeasy Mini Kit (QIAGEN); thereafter, cdna was synthesized using iscript cdna Synthesis Kit according to the manufacturer s instructions. Real-time quantitative PCR (qpcr) was performed as previously described (2). Primer sequences are listed in Table 1. Oil Red O Staining Muscles were dissected, sectioned, and stained with Oil Red O (ORO), and the staining was quantified as previously reported (10). Glucose Measurements and Metabolic Tests Body weights and postprandial blood glucose levels were measured by intraperitoneal glucose tolerance tests (IPGTTs) and intraperitoneal insulin tolerance tests (IPITTs) performed in mice as previously described (2). Pooled data from at least two independent experiments, totaling animals per genotype, were included in the analysis. Metabolic analyses of mouse plasma were performed as previously described (2). HOMA of insulin resistance (HOMA-IR) was calculated as (fasting glucose [mmol/l] 3 fasting insulin [mu/l])/22.5. Immunohistological Analyses of Muscle Sections Muscles were flash frozen in liquid nitrogen, cryosectioned into 12-mm sections, and stained using standard Figure 1 PGC-1a activates the Vegfb promoter through coactivation of ERR-a. A: Relative luciferase activity in cells transfected with the first kb of a Vegfb promoter/intron reporter construct, plus vectors expressing PGC-1a, ERR-a, NRF1, or PPARG (n = 4/ construct). B: Relative luciferase activity in COS-1 cells transfected with the Vegfb promoter/intron reporter construct, with deletion constructs or with constructs where the indicated putative Esrra binding sites were mutated plus vectors expressing PGC-1a and ERR-a. C E: Relative muscular mrna expression of Ppargc1a, Vegfb, and Esrra (C); Vegfa, Tfam, Ndufa5, Ndufb10, and Cycs (D); and Cd36, Fatp1, Fatp3, and Fatp4 (E) in chow-fed WT, MPGC-1aTG, and MPGC-1aTG//Vegfb 2/2 mice (n =6 7 for each genotype). Data are mean 6 SEM. *P < 0.05, **P < 0.01, ***P < 0.001, MPGC-1aTG or MPGC-1aTG//Vegfb 2/2 compared with WT; ##P < 0.01, ###P < 0.001, MPGC-1aTG//Vegfb 2/2 compared with MPGC-1aTG; P < 0.001, control construct compared with PGC-1a + ERR-a reporter construct or mutated construct. a.u., arbitrary unit; D, mutated bp; Luc, transcription start site of the luciferase reporter gene.

4 864 PGC-1a Regulates Vegfb Expression Diabetes Volume 65, April 2016 Figure 2 Muscular lipid accumulation is decreased in MPGC-1aTG mice lacking Vegfb expression. Analysis of chow-fed WT, MPGC-1aTG, MPGC-1aTG//Vegfb 2/2 (n =6 10 for each genotype), and Vegfb 2/2 mice (n = 3 7). A: Representative images showing ORO staining of muscle sections. B: Relative muscular mrna expression of Acox1, Acadm, Acadvl, andfasn. C: Postprandial blood glucose levels. D: IPGTT. E and F: Relative mrna expression of Glut1 (gene name Slc2a1) and insulin-sensitive glucose transporter Glut4 (gene name Slc2a4) (E) andhk2, Pdk4, andcs (F). Data are mean 6 SEM. Scale bar = 100 mm. Inset magnification 36. *P < 0.05, **P < 0.01, ***P < 0.001, MPGC-1aTG or MPGC-1aTG//Vegfb 2/2 compared with WT; #P < 0.05, ##P < 0.01, MPGC-1aTG//Vegfb 2/2 compared with MPGC-1aTG. Acadm, acyl-coa dehydrogenase, medium chain; Acadvl, acyl-coa dehydrogenase, very long chain; Acox1, acyl-coa oxidase 1; a.u., arbitrary unit; Fasn; fatty acid synthase; Hk2, hexokinase 2; ns, not significant; Slc2a1, solute carrier family 2 (facilitated glucose transporter), member 1; Slc2a4, solute carrier family 2 (facilitated glucose transporter), member 4. procedures. The primary antibodies were goat anti-fatp3 (Santa Cruz Biotechnology, Santa Cruz, TX), rat anti- CD31 (BD Biosciences, San Jose, CA), rabbit anti- FATP4 (Santa Cruz Biotechnology), and goat anti-cd31 (R&D Systems, Minneapolis, MN). At least 10 frames per animal within each section were photographed with an AxioVision microscope (Carl Zeiss, Oberkochen, Germany) at 340 magnification. For quantification of the stainings, the number of pixels per square micrometer was calculated using the AxioVision quantification program. Ex Vivo b-oxidation Assay b-oxidation activity was measured in isolated skeletal muscle preparations as previously described (1). Liquid Chromatography Mass Spectrometry Based Lipidomic Analysis Ten milligrams of muscle tissue were analyzed by ultrafast liquid chromatography mass spectrometry (LC-MS) based lipidomic analysis by the Swedish Metabolomics Centre at the Swedish University of Agricultural Sciences. The analyses were carried out as previously described (11). Statistics In all figures, data are presented as mean 6 SEM, with n referring to the number of independent data points. P values were calculated with two-tailed Student t test, and P, 0.05 was considered significant.

5 diabetes.diabetesjournals.org Mehlem and Associates 865 Figure 3 HFD feeding induces the expression of Vegfb and genes for FA handling proteins, whereas expression of mitochondrial OXPHOS genes are decreased. A and B: Relative muscular mrna expression of Vegfb, Esrra, Fatp1, Cd36, Fatp3, and Fatp4 (A) and Ndufa5, Ndufb10, Tfam, and Cycs (B) in chow-fed and HFD-fed WT, MPGC-1aTG, and MPGC-1aTG//Vegfb 2/2 mice (n =4 7 for each genotype). Data are mean 6 SEM. For clarity, only significance between chow-fed and HFD-fed animals within genotypes and HFD-fed MPGC-1aTG compared with MPGC-1aTG//Vegfb 2/2 mice are indicated. P < 0.05, P < 0.01, P < 0.001, HFD compared with chow; #P < 0.05, ##P < 0.01, ###P < 0.001, HFD-fed MPGC-1aTG//Vegfb 2/2 compared with HFD-fed MPGC-1aTG. ns., not significant. RESULTS PGC-1a and ERR-a Regulate Vegfb Promoter Activity To investigate whether Vegfb can be induced by starvation, we monitored the expression levels of Ppargc1a and Vegfb in serum-deprived C2C12 myotubes (Supplementary Fig. 1). Eight hours of nutrient deprivation induced the expression of both Ppargc1a and Vegfb by 2.5- and 1.5-fold, respectively, and the induction was increased to 3.5- and 1.8-fold after 16 h of starvation (Supplementary Fig. 1A). The induced expression of Ppargc1a and Vegfb upon nutrient deprivation was confirmed in fibroblast (COS-1) and pericyte precursor (10T1/2) cell lines (Supplementary Fig. 1B and C). We characterized the Vegfb promoter by cloning the first kb of the 59-untranslated region and the first exon and intron of the Vegfb gene in front of a luciferase reporter construct. Plasmids encoding PGC-1a and/or the transcription factors ERR-a, NRF1, or PPARg were then cotransfected with the luciferase reporter construct in COS-1 cells (Fig. 1A). The results show that only coexpression of PGC-1a and ERR-a induced significant transactivation of the reporter construct. To identify putative ERR-a binding sites in the Vegfb promoter, the murine genomic sequence was analyzed by the ECR Browser, Mulan, and multitf algorithms (9,12). The analyses identified two ERR-a consensus DNA binding sites (13) located in the 59promoter region (2315 to 2310) and in the first intron of the Vegfb gene (+340 to +345) and one putative binding site (2571 to 2566) (Fig. 1B). To identify the ERR-a binding sites responsible for the transactivation of the Vegfb promoter, new reporter constructs were generated where each ERR-a binding site was mutated by a single bp substitution. No luciferase activity was detected in the absence of PGC-1a and ERR-a, showing that the Vegfb construct per se did not induce luciferase activity (Fig. 1B, upper bar). Cotransfection of PGC-1a and ERR-a with WT or modified luciferase constructs revealed that mutating the 2571 to 2566 binding site significantly decreased luciferase activity compared with control reporter constructs (Fig. 1B). Mutations in the two other ERR-a DNA binding sites did not decrease luciferase activity. However, additional cryptic ERR-a binding sites most likely exist between 20.5and0kb in the Vegfb promoter and in the first intron of the Vegfb gene because reporter constructs of both these genomic regions alone also displayed high luciferase activity (Fig. 1B). We crossed MPGC-1aTG mice (6) with Vegfb-deficient animals (3) to ultimately create MPGC-1aTG//Vegfb 2/2 mice. qpcr analysis demonstrated a sevenfold increase in muscular expression of Ppargc1a transcripts in MPGC- 1aTG mice compared with WT controls (Fig. 1C). Similar

6 866 PGC-1a Regulates Vegfb Expression Diabetes Volume 65, April 2016 Figure 4 Muscular lipid accumulation and expression of FATPs are reduced in HFD-fed MPGC-1aTG mice lacking Vegfb. Analysis of HFD-fed WT, MPGC-1aTG, MPGC-1aTG//Vegfb 2/2 mice (n =6 10 for each genotype), and Vegfb 2/2 mice (n =3 7). A: Representative images showing ORO staining of muscle sections; quantification of the ORO staining is shown on the right. B: Relative muscular mrna expression of Acox1, Acadm, Acadvl, and Fasn. C: Ex vivo b-oxidation measured as levels of formed 14 CO 2 in skeletal muscles from HFDfed MPGC-1aTG mice and MPGC-1aTG//Vegfb 2/2 mice. Etomoxir was used to inhibit mitochondrial b-oxidation and served as an internal control (n = 2 3). D: Representative images of muscle sections stained with anti-fatp3 or anti-fatp4 antibodies together with CD31 antibodies. Quantifications are shown on the right (n =3 6). Data are mean 6 SEM. *P < 0.05, **P < 0.01, ***P < 0.001, MPGC-1aTG or MPGC-1aTG//Vegfb 2/2 compared with WT; ##P < 0.01, ###P < 0.001, MPGC-1aTG//Vegfb 2/2 compared with MPGC-1aTG. In A, scale bar = 100 mm and inset magnification 36, whereas in D, scale bars = 50 mm and 100 mm in top vs. bottom panels. Acadm, acyl-coa dehydrogenase, medium chain; Acadvl, acyl-coa dehydrogenase, very long chain; Acox1, acyl-coa oxidase 1; a.u., arbitrary unit; Cd31, platelet endothelial cell adhesion molecule; Fasn; fatty acid synthase. analyses showed six- and threefold upregulation of the expression of Vegfb and Esrra, respectively (Fig. 1C). MPGC-1aTG mice also showed an approximate twofold upregulation of the previously reported PGC-1a target genes Vegfa; transcription factor A, mitochondrial (Tfam); NADH dehydrogenase (ubiquione) 1 a subcomplex 5(Ndufa5); NADH dehydrogenase (ubiquione) 1 b subcomplex 10 (Ndufb10); and cytochrome C, somatic (Cycs)

7 diabetes.diabetesjournals.org Mehlem and Associates 867 Figure 5 Ablation of Vegfb in HFD-fed mice reduced muscular levels of TGs, DAGs, and ceramides. LC-MS analysis of muscle biopsy specimens from chow-fed WT and HFD-fed WT, MPGC-1aTG, MPGC-1aTG//Vegfb 2/2, and Vegfb 2/2 mice. A: Total ion chromatogram (TIC) of TGs and quantification of total TG content by AUC. B: Quantification of the most abundant TG species as fold change compared with chow-fed WT. C: TIC of DAGs and quantification of total DAG content by AUC. D: Quantification of the most abundant DAG species as fold change compared with chow-fed WT. E: TIC of ceramides and quantification of the total ceramide content by AUC. F: Quantification of the most abundant ceramide species as fold change compared with chow-fed WT. G and H: Relative muscular mrna expression of Atgl and Plpp1 (G) and Cers2 and Sptlc1 (H). Data are mean 6 SEM. Statistical analyses between chow-fed and HFD-fed WT are omitted for clarity.

8 868 PGC-1a Regulates Vegfb Expression Diabetes Volume 65, April 2016 (Fig. 1C and D). Ablation of Vegfb in MPGC-1aTG mice did not affect the expression of any of these genes. We analyzed muscular expression of FATPs and several other FA handling proteins previously reported to be regulated by PGC-1a (14). The expression of fatty acid translocase (Cd36), Fatp1, and Fatp4 was upregulated in MPGC-1aTG mice compared with WT mice (Fig. 1E). Fatp3, the vascular-specific target of VEGF-B signaling, was downregulated in the MPGC-1aTG//Vegfb 2/2 mice compared with the WT and MPGC-1aTG animals (Fig. 1E). Taken together, PGC-1a and ERR-a regulate Vegfb expression, which requires at least one intact ERR-a binding site located in the promoter region of Vegfb. In vivo, PGC-1a controls Vegfb expression in parallel with the expression of OXPHOS genes and Vegfa. The expression of the OXPHOS genes was not altered by Vegfb deletion, whereas Fatp3 was downregulated only in the MPGC- 1aTG//Vegfb 2/2 mice. Muscular Lipid Accumulation Is Reduced in MPGC-1aTG//Vegfb 2/2 Mice Muscle sections from WT, MPGC-1aTG, MPGC-1aTG// Vegfb 2/2,andVegfb 2/2 mice were stained with ORO to visualize accumulation of neutral lipids. Quantifications showed a fivefold increase in lipid accumulation in MPGC-1aTG compared with WT mice (Fig. 2A). In contrast, MPGC-1aTG//Vegfb 2/2 mice had almost normalized levels of lipid accumulation (Fig. 2A). The lowest level of lipid accumulation was detected in Vegfb 2/2 mice,inlinewithpreviousresults(1). Intracellular lipids can accumulate either through increased FA uptake, decreased b-oxidation, or increased de novo FA synthesis. Therefore, muscular expression of genes encoding critical enzymes in b-oxidation and de novo FA synthesis were measured by qpcr analysis (Fig. 2B). The transcript levels of regulatory genes in b-oxidation and de novo FA synthesis were upregulated in MPGC-1aTG compared with WT mice (Fig. 2B), which is in line with previous reports (7). No further increase in the expression of any of the genes was detected in MPGC-1aTG//Vegfb 2/2 mice (Fig. 2B), and in line with previous studies, no difference in expression levels of these genes was detected between WT and Vegfb 2/2 mice (1). Vegfb 2/2 mice have a shift in nutrient utilization toward increased use of glucose and decreased use of FAs compared with WT animals (1). However, on chow diet, no differences in postprandial blood glucose levels or glucose tolerance were detected among WT, MPGC- 1aTG, MPGC-1aTG//Vegfb 2/2,andVegfb 2/2 mice (Fig. 2C and D). A minor increase in the muscular expression of Glut4 (gene name Slc2a4) but not of Glut1 (gene name Slc2a1) was detected in MPGC-1aTG//Vegfb 2/2 mice compared with MPGC-1aTG mice (Fig. 2E). PGC-1a/ ERR-a has been reported to regulate glucose utilization by controlling the expression of several intracellular glucose handling enzymes (15,16); therefore, we assessed muscular expression of these transcripts in WT, MPGC-1aTG, MPGC-1aTG//Vegfb 2/2, and Vegfb 2/2 mice (Fig. 2F). Muscular pyruvate dehydrogenase kinase 4(Pdk4) expression was downregulated, with ;60% in MPGC-1aTG//Vegfb 2/2 and Vegfb 2/2 mice compared with MPGC-1aTG mice. A minor increase in citrate synthase (Cs) levels (25%) were detected in MPGC-1aTG// Vegfb 2/2 compared with MPGC-1aTGmice.Insummary, no major differences in glucose tolerance, blood glucose levels, or expression of glucose transporters were found between WT and MPGC-1aTG, MPGC-1aTG// Vegfb 2/2,andVegfb 2/2 mice on chow diet. VEGF-B Is Regulated by PGC-1a in HFD Mice and Controls Muscular Lipid Accumulation Through FATPs To characterize the impact of VEGF-B driven muscular lipid accumulation of the diabetic phenotype in HFD-fed MPGC-1aTG mice, transcriptional profiling of Vegfb and genes involved in lipid uptake and oxidation were analyzed in chow- and HFD-fed animals. Vegfb expression was induced fourfold by HFD feeding in WT mice compared with chow-fed mice and twofold in HFD-fed MPGC- 1aTG mice compared with chow-fed MPGC-1aTG mice (Fig. 3A). HFD feeding did not increase Esrra levels in any of the mouse strains compared with the respective genotype fed the chow diet (Fig. 3A). However, HFD feeding increased muscular expression of genes encoding FA handling proteins in both WT and MPGC-1aTG mice (Fig. 3A). Deletion of Vegfb in the HFD-fed MPGC-1aTG mice significantly prevented the upregulation of Fatp4 (Fig. 3A). On the contrary, the expression of mitochondrial genes was reduced upon HFD feeding in WT, as previously reported (2), and also in MPGC-1aTG mice (Fig. 3B). Deletion of Vegfb in the HFD-fed MPGC-1aTG preserved the expression of several OXPHOS genes compared with MPGC-1aTG mice (Fig. 3B). Thus, transcriptional analysis suggested that HFD feeding induced an imbalance between lipid uptake and lipid oxidation, and reducing VEGF-B levels may prevent this, leading to metabolic normalization. To analyze whether ablation of Vegfb reduced muscular FA uptake during HFD, muscular tissue sections from the various genotypes were stained with ORO. Muscular lipid accumulation was increased eightfold in HFD-fed MPGC-1aTG mice compared with WT HFD-fed mice but only fourfold in MPGC-1aTG//Vegfb 2/2 mice *P < 0.05, **P < 0.01, ***P < 0.001, MPGC-1aTG or MPGC-1aTG//Vegfb 2/2 compared with WT; #P < 0.05, ##P < 0.01, MPGC-1aTG// Vegfb 2/2 compared with MPGC-1aTG (n =3 6). a.u., arbitrary unit; Cers2, ceramide synthase 2; Sptlc1, serine palmitoyltransferase, long chain base subunit 1.

9 diabetes.diabetesjournals.org Mehlem and Associates 869 (Fig. 4A). Hence, deletion of Vegfb alone in MPGC-1aTG mice lowered muscular lipid accumulation by 80%. In accordance with our previous findings (2), the lowest levels of lipid accumulation was seen in the HFD-fed Vegfb 2/2 mice. The decreased muscular lipid accumulation in HFDfed MPGC-1aTG//Vegfb 2/2 mice was not due to a compensatory increase in b-oxidation or decrease in de novo FA synthesis because transcript levels of the regulatory genes in these pathways were not altered (Fig. 4B). We also assessed whether genetic ablation of Vegfb in HFDfed MPGC-1aTG mice directly affected the capacity of b-oxidation by incubating isolated skeletal muscle preparations with 14 C-oleic acid and measured formed 14 CO 2 (Fig. 4C). However, no differences in the levels of released 14 CO 2 were observed between genotypes. The transcriptional alterations of the FATPs were modest in relation to the drastic reduction in lipid accumulation in the HFD-fed MPGC-1aTG//Vegfb 2/2 mice, and we used immunohistochemistry to analyze protein expression of FATP3 and FATP4 in chow-fed WT, HFD-fed WT, MPGC-1aTG, MPGC-1aTG//Vegfb 2/2, and Vegfb 2/2 mice (Fig. 4D). CD31, a vessel-specific marker protein, was used to identify vascular localization of the FATPs. The expression of both FATP3 and FATP4 was strongly upregulated in HFD-fed MPGC-1aTG mice compared with HFD-fed WT mice. Strikingly, the protein expression of both FATP3 and FATP4 were downregulated by ;70% and 90% in HFD-fed MPGC-1aTG//Vegfb 2/2 and HFD-fed MPGC-1aTG mice, respectively. In summary, HFD feeding induced the expression of Vegfb and FA handling protein transcripts in both WT and MPGC- 1aTG mice, and muscular lipid deposition was increased accordingly. Of note, muscular lipid accumulation was dramatically reduced in the MPGC-1aTG//Vegfb 2/2 mice, which was caused by lowered FA uptake through decreased expression of FATP3 and FATP4. Ablation of Vegfb in HFD-Fed Mice Targets Muscular Lipid Accumulation by Reducing Triglycerides, Diacylglycerols, and Ceramides High intramyocellular lipid content in both humans and experimental animal models have been shown to be associated with insulin resistance (17,18). Specifically, both diacylglycerols (DAGs) derived from lipid droplets and ceramides have been shown to affect insulin signaling and/or insulin-mediated muscular glucose uptake (19). Therefore, we used ultrafast LC-MS based Figure 6 Genetic deletion of Vegfb in HFD-fed MPGC-1aTG mice reduces insulin resistance and type 2 diabetes. Analysis of chowfed WT (n = 4 5) and HFD-fed WT, MPGC-1aTG, MPGC-1aTG// Vegfb 2/2, and Vegfb 2/2 mice (n =7 12 for each genotype). A: Postprandial blood glucose levels and body weights. B: Insulin levels and HOMA-IR. C and D: Relative mrna expression of Glut1 (gene name Slc2a1) and insulin sensitive glucose transporter Glut4 (gene name Slc2a4) (C) and Hk2, Pdk4, and Cs (D). E and F: IPGTT (E) and IPITT (F) and AUC analyses. Data are mean 6 SEM. Statistical analyses between chow-fed and HFD-fed WT are omitted for clarity. *P < 0.05, **P < 0.01, ***P < 0.001, MPGC-1aTG// Vegfb 2/2 or Vegfb 2/2 compared with WT; #P < 0.05, ##P < 0.01, ###P < 0.001, MPGC-1aTG//Vegfb 2/2 or Vegfb 2/2 compared with MPGC-1aTG. a.u., arbitrary unit; Hk2, hexokinase 2; Slc2a1, solute carrier family 2 (facilitated glucose transporter), member 1; Slc2a4, solute carrier family 2 (facilitated glucose transporter), member 4.

10 870 PGC-1a Regulates Vegfb Expression Diabetes Volume 65, April 2016 lipidomics to quantify the levels of triglycerides (TGs), DAGs, and ceramides in muscle biopsy specimens from chow-fed WT mice and HFD-fed WT, MPGC-1aTG, MPGC-1aTG//Vegfb 2/2,andVegfb 2/2 mice (Fig. 5). Area under the curve (AUC) analysis of all lipid species showed that MPGC-1aTG//Vegfb 2/2 and Vegfb 2/2 mice had ;35% and 60% lower muscular TG content, respectively, compared with MPGC-1aTG mice (Fig. 5A and B). Similar analysis showed that muscular levels of DAGs and ceramides were reduced by ;35% and 25% in MPGC- 1aTG//Vegfb 2/2 mice and by ;70% and 35% in Vegfb 2/2 mice compared with MPGC-1aTG mice (Fig. 5C F). To analyze whether VEGF-B controls the degradation of TGs to DAGs or de novo DAG synthesis, we measured muscular expression levels of adipose triglyceride lipase (Atgl) and phospholipid phosphatase 1 (Plpp1) (Fig.5G). Expression of Atgl was downregulated in both HFD-fed MPGC-1aTG//Vegfb 2/2 and Vegfb 2/2 mice, suggesting that lower amounts of TGs are available for degradation. No differences were found between genotypes in expression of Plpp1 or in the expression of transcripts coding for key enzymes for ceramide formation (Fig. 5G and H). MPGC-1aTG//Vegfb 2/2 Mice Fed an HFD Are Protected Against the Development of Type 2 Diabetes We analyzed whether deletion of Vegfb could reverse insulin resistance in HFD-fed MPGC-1aTG mice (Fig. 6). Postprandial blood glucose levels were normalized in HFD-fed MPGC-1aTG//Vegfb 2/2 and Vegfb 2/2 animals (Fig. 6A). As previously reported, Vegfb 2/2 mice had an increased body weight compared with WT littermates upon HFD feeding (Fig. 6A) (2). However, no differences in body weights were detected among WT, MPGC-1aTG, and MPGC-1aTG//Vegfb 2/2 mice (Fig. 6A). HFD-fed WT and MPGC-1aTG mice but not MPGC-1aTG//Vegfb 2/2 mice developed hyperinsulinemia, whereas HFD-fed Vegfb 2/2 mice displayed moderately increased plasma insulin levels (Fig. 6B). The HOMA-IR index mirrored the plasma insulin levels (Fig. 6B). qpcr analysis showed that MPGC-1aTG//Vegfb 2/2 mice had higher Glut4 expression (Fig. 6C), lower Pdk4 expression (Fig. 6D), and higher Cs expression (Fig. 6D) compared with MPGC-1aTG mice, suggesting higher glucose utilization (20). In line with reduced muscular lipid accumulation and increased expression of glucose handling enzymes, the HFD-fed MPGC-1aTG//Vegfb 2/2 and Vegfb 2/2 mice showed improved glucose tolerance and insulin sensitivity compared with HFD-fed WT and MPGC-1aTG mice (Fig. 6E and F). To visualize how insulin resistance correlated to VEGF-B signaling and muscular lipid accumulation, we plotted muscular lipid content and measurements of insulin resistance in individual HFD-fed mice (Fig. 7A). HFD-fed MPGC-1aTG were characterized by high muscular lipid content and insulin resistance. Reducing Vegfb 2/2 levels in HFD-fed MPGC-1aTG mice strongly affected lipid accumulation and increased insulin sensitivity. In summary, deletion of Vegfb can completely prevent insulin resistance in HFD-fed MPGC-1aTG mice. In addition to insulin resistance, dyslipidemia is a key feature of type 2 diabetes. Hence, the levels of several plasma lipid species were analyzed in HFD-fed mice (Fig. 7B and C). The results showed that HFD feeding leads to increased levels of plasma TGs in WT and MPGC-1aTG mice. In contrast, TG levels were decreased in HFD-fed MPGC-1aTG//Vegfb 2/2 and Vegfb 2/2 mice compared with both WT and MPGC-1aTG animals (Fig. 7B). LDL and VLDL cholesterol were also decreased in MPGC- 1aTG//Vegfb 2/2 mice compared with MPGC-1aTG mice, whereas no difference in HDL cholesterol was detected (Fig. 7B). Similar levels of nonesterified fatty acids (NEFAs) and ketone bodies (KBs) were also detected in MPGC-1aTG and MPGC-1aTG//Vegfb 2/2 mice (Fig. 7C). In summary, the metabolic tolerance tests showed that genetic deletion of Vegfb in HFD-fed MPGC-1aTG mice is sufficient to prevent hyperglycemia and hyperinsulinemia, reduce insulin resistance, and improve dyslipidemia, thus rescuing the aberrant phenotype of this previously enigmatic mouse model. DISCUSSION In this study, we demonstrate that Vegfb is a downstream target of the PGC-1a/ERR-a signaling pathway. PGC-1a is induced by physiological stimuli, including exercise, fasting, and cold temperature (4). Of note, mrna levels of Vegfb are also increased by nutrient deprivation (Supplementary Fig. 1) and during exercise, which is shown in muscles biopsy specimens from mice and human subjects (21,22). The coregulation of PGC-1a and VEGF-B ensures that lipid uptake from the circulation is coordinated with tissue lipid oxidation (Fig. 7D). PGC-1a/ERR-a have also been shown to induce VEGF-A levels and angiogenesis in skeletal muscle in vivo during starvation (8,23 25). Thus, PGC-1a and ERR-a coordinate VEGF-A and VEGF-B expression levels, mitochondrial biogenesis, and lipid oxidation not only by controlling vessel growth but also by regulating lipid uptake. Given the impact of PGC-1a as the main activator of mitochondrial biogenesis and energy metabolism, efforts have been made to elucidate the role of PGC-1a in metabolic conditions such as insulin resistance and type 2 diabetes. The muscular expression of Ppargc1a and OXPHOS genes is reduced in patients with type 2 diabetes, suggesting that low PGC-1a activity could be the underlying mechanism of type 2 diabetes (26,27). Therefore, it was surprising and paradoxical that HFD-fed MPGC- 1aTG mice developed insulin resistance and type 2 diabetes (7). In this study, we have unraveled the mechanism underlying the diabetic phenotype reported for the HFD-fed MPGC-1aTG mice (7). We show that muscular overexpression of PGC-1a upregulates Vegfb levels, driving FA uptake and tissue accumulation and, as a consequence, insulin resistance. Inactivation of Vegfb in HFDfed MPGC-1aTG mice reduced ectopic lipid accumulation

11 diabetes.diabetesjournals.org Mehlem and Associates 871 Figure 7 Reducing VEGF-B levels in HFD-fed mice targets intramyocellular lipid storage, insulin resistance, and dyslipidemia. A and B: Analysis of chow-fed WT (n = 4 5) and HFD-fed WT, MPGC-1aTG, MPGC-1aTG//Vegfb 2/2, and Vegfb 2/2 mice (n = 7 12 for each genotype). A: Neutral lipid accumulation quantified by ORO analysis plotted against the levels of insulin resistance as measured by AUC analysis of IPITTs. B and C: Plasma levels of TGs, HDL cholesterol, and LDL/VLDL cholesterol (B) and NEFAs, and ketones (C). D: Schematic illustration of PGC-1a dependent regulation of VEGF-B and VEGF-A and how b-oxidation is correlated to FA uptake and angiogenesis. In the normal state, PGC-1a coordinates mitochondrial biogenesis and b-oxidation with FA uptake and angiogenesis by coexpression of mitochondrial OXPHOS genes Vegfb and Vegfa. During nutrient deprivation and/or exercise, the expression of PGC-1a induces mitochondrial biogenesis that subsequently upregulates expression of VEGF-B and induces FA uptake in the tissue cells and induces expression of VEGF-A with and the development of type 2 diabetes by reduced protein levels of endothelial FATPs. Hence, the HFD-induced insulin resistance in MPGC-1aTG mice first described by Choi et al. (7) is most likely caused by a PGC-1a dependent upregulation of Vegfb expression. Ablation of Vegfb in MPGC-1aTG mice did not affect plasma levels of NEFAs or KBs, despite reduction of muscular lipid accumulation. The current data agree with that of Choi et al. (7), which showed that HFD-fed MPGC- 1aTG mice had lower plasma levels of KB, despite increased muscular FA inflow. We have previously shown that reducing VEGF-B levels in db/db mice reduced both muscular lipid accumulation and plasma levels of NEFAs and KBs (2). Furthermore, lipid infusions in unchallenged Vegfb 2/2 mice redirected lipids from the peripheral tissues to the adipose tissue (AT) (1). PGC-1a is described as a regulator of several myokines shown to induce alterations in the AT (22). Therefore, the lack of differences in plasma NEFA levels between MPGC-1aTG and MPGC- 1aTG//Vegfb 2/2 could be caused either by the effect of PGC-1a on AT tissue or by VEGF-B dependent shunting of lipids to the AT. Efforts have been made to try to link the VEGF-B signaling pathway to insulin resistance in humans, but it was reported that serum VEGF-B levels did not differ between patients with type 2 diabetes and healthy control subjects (28). However, a major confounding factor was that the trial enrolled patients taking oral antidiabetic drugs, such as metformin and thiazolidinediones. The authors showed that thiazolidinediones reduced circulating levels of VEGF-B. Similarly, in a more recent clinical trial of metformin treatment in women with polycystic ovary syndrome and insulin resistance, metformin was shown to reduce plasma VEGF-B levels (29). This trial enrolled only patients who had not received antidiabetic drugs within the past 3 months before the metformin treatment was initiated. Measurements of serum VEGF-B levels before metformin treatment showed that VEGF-B levels were increased in the subjects with insulin resistance and correlated positively with insulin resistance. In addition, gene association studies have linked the VEGF-B signaling pathway to insulinresistanceinhumansbecauseasequencevariant in Fatp4 was identified to be associated with the metabolic syndrome and insulin resistance (30). Moreover, serumvegf-blevelsaswellasatvegfb expression have subsequent angiogenesis. This type of regulation ensures that increased blood vessel growth and nutrient supply are correlated with the higher oxidative capacity in the tissue to preserve the metabolic homeostasis. Data in B and C are mean 6 SEM. Statistical analyses between chow-fed and HFD-fed WT are omitted for clarity. *P < 0.05, **P < 0.01, HFD-fed MPGC-1aTG//Vegfb 2/2 or Vegfb 2/2 compared with HFD-fed WT; #P < 0.05, ##P < 0.01, HFD-fed MPGC-1aTG//Vegfb 2/2 or Vegfb 2/2 compared with HFD-fed MPGC-1aTG. a.u., arbitrary unit.

12 872 PGC-1a Regulates Vegfb Expression Diabetes Volume 65, April 2016 been shown to be upregulated in patients who are obese (31,32). Taken together, several human studies have shown interesting links among VEGF-B levels, obesity, and insulin resistance. In summary, the current study identifies Vegfb as a downstream target of the PGC-1a/ERR-a signaling pathway and a mediator of the PGC-1a induced adverse effects upon HFD feeding. We provide evidence that tissue metabolism is intimately linked to the functional features of the vasculature and highlights the importance of PGC- 1a as a major metabolic sensor/regulator to coordinate respiratory capacity with vessel growth through VEGF-A and lipid uptake through VEGF-B. Acknowledgments. The authors thank Janet Rossant (Departments of Molecular Genetics and Obstetrics and Gynaecology, University of Toronto) and Guo-Hua Fong (Department of Cell Biology and Center for Vascular Biology, University of Connecticut Health Center) for the gift of the MPGC-1aTG mice; Thomas Perlmann (Department of Cell and Molecular Biology, Karolinska Institutet) for the gifts of pcmx-err-a, pcdna3.1/myc-hisa-pgc-1a-flag, ptk-luc, pcmx-b-gal plasmids; and the Swedish Metabolomics Centre (Umeå University; for help with lipid analysis. The authors also thank Sofia Wittgren and Karin Pettersson (Department of Medical Biochemistry and Biophysics, Karolinska Institutet) for mouse care and mouse genotyping. Funding. This study was supported by the Wilhelm och Else Stockmanns Stiftelse (C.E.H.), Swedish Heart-Lung Foundation (U.E.), Novo Nordisk Foundation (U.E.), Swedish Cancer Foundation (U.E.), Swedish Research Council (U.E.), Torsten Söderbergs Stiftelse (U.E.), Ragnar Söderbergs Stiftelse (U.E.), Ludwig Institute for Cancer Research (U.E.), CSL Ltd., Melbourne, Australia (U.E.), and Karolinska Institutet. Duality of Interest. A.M., U.E., and A.F. are shareholders in a company within the diabetes field. This study was supported by CSL Ltd., Melbourne, Australia (U.E.). U.E. is a consultant for CSL Ltd., Melbourne, Australia. This does not alter the author s adherence to all policies of Diabetes. No other potential conflicts of interest relevant to this article were reported. Author Contributions. A.M. and A.F. contributed to the study design and research, data analysis, and writing and review of the manuscript. I.P. performed expression, immunohistochemistry, and lipid analyses and contributed to the review of the manuscript. X.W. performed the in vitro analysis and contributed to the in vivo experiments and review of the manuscript. C.E.H. initiated the project and contributed to the review of the manuscript. U.E. designed the research and contributed to the review of the manuscript. U.E. and A.F. are the guarantors of this work and, as such, had full access to all data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. Prior Presentation. Parts of this study were presented in abstract form at 2013 Keystone Symposia on Molecular and Cellular Biology Diabetes New Insights into Mechanism of Disease and its Treatment, Keystone, CO, 27 January 1 February References 1. Hagberg CE, Falkevall A, Wang X, et al. Vascular endothelial growth factor B controls endothelial fatty acid uptake. Nature 2010;464: Hagberg CE, Mehlem A, Falkevall A, et al. Targeting VEGF-B as a novel treatment for insulin resistance and type 2 diabetes. Nature 2012;490: Aase K, von Euler G, Li X, et al. Vascular endothelial growth factor-bdeficient mice display an atrial conduction defect. Circulation 2001;104: Chan MC, Arany Z. The many roles of PGC-1a in muscle recent developments. Metabolism 2014;63: Lowell BB, Shulman GI. Mitochondrial dysfunction and type 2 diabetes. Science 2005;307: Lin J, Wu H, Tarr PT, et al. Transcriptional co-activator PGC-1 alpha drives the formation of slow-twitch muscle fibres. Nature 2002;418: Choi CS, Befroy DE, Codella R, et al. Paradoxical effects of increased expression of PGC-1alpha on muscle mitochondrial function and insulinstimulated muscle glucose metabolism. Proc Natl Acad Sci U S A 2008;105: Arany Z, Foo SY, Ma Y, et al. HIF-independent regulation of VEGF and angiogenesis by the transcriptional coactivator PGC-1alpha. Nature 2008;451: Ovcharenko I, Loots GG, Giardine BM, et al. Mulan: multiple-sequence local alignment and visualization for studying function and evolution. Genome Res 2005;15: Mehlem A, Hagberg CE, Muhl L, Eriksson U, Falkevall A. Imaging of neutral lipids by oil red O for analyzing the metabolic status in health and disease. Nat Protoc 2013;8: Nygren H, Seppänen-Laakso T, Castillo S, Hyötyläinen T, Orešic M. Liquid chromatography-mass spectrometry (LC-MS)-based lipidomics for studies of body fluids and tissues. Methods Mol Biol 2011;708: Ovcharenko I, Nobrega MA, Loots GG, Stubbs L. ECR Browser: a tool for visualizing and accessing data from comparisons of multiple vertebrate genomes. Nucleic Acids Res 2004;32:W280 W Sladek R, Bader JA, Giguère V. The orphan nuclear receptor estrogenrelated receptor alpha is a transcriptional regulator of the human medium-chain acyl coenzyme A dehydrogenase gene. Mol Cell Biol 1997;17: Summermatter S, Baum O, Santos G, Hoppeler H, Handschin C. Peroxisome proliferator-activated receptor gamma coactivator 1alpha (PGC-1alpha) promotes skeletal muscle lipid refueling in vivo by activating de novo lipogenesis and the pentose phosphate pathway. J Biol Chem 2010;285: Pilegaard H, Neufer PD. Transcriptional regulation of pyruvate dehydrogenase kinase 4 in skeletal muscle during and after exercise. Proc Nutr Soc 2004; 63: Wende AR, Huss JM, Schaeffer PJ, Giguère V, Kelly DP. PGC-1alpha coactivates PDK4 gene expression via the orphan nuclear receptor ERRalpha: a mechanism for transcriptional control of muscle glucose metabolism. Mol Cell Biol 2005;25: Krssak M, Petersen KF, Bergeron R, et al. Intramuscular glycogen and intramyocellular lipid utilization during prolonged exercise and recovery in man: a 13 C and 1 H nuclear magnetic resonance spectroscopy study. J Clin Endocrinol Metab 2000;85: Clerk LH, Rattigan S, Clark MG. Lipid infusion impairs physiologic insulinmediated capillary recruitment and muscle glucose uptake in vivo. Diabetes 2002;51: Samuel VT, Petersen KF, Shulman GI. Lipid-induced insulin resistance: unravelling the mechanism. Lancet 2010;375: Majer M, Popov KM, Harris RA, Bogardus C, Prochazka M. Insulin downregulates pyruvate dehydrogenase kinase (PDK) mrna: potential mechanism contributing to increased lipid oxidation in insulin-resistant subjects. Mol Genet Metab 1998;65: Vind BF, Pehmøller C, Treebak JT, et al. Impaired insulin-induced sitespecific phosphorylation of TBC1 domain family, member 4 (TBC1D4) in skeletal muscle of type 2 diabetes patients is restored by endurance exercise-training. Diabetologia 2011;54: Boström P, Wu J, Jedrychowski MP, et al. A PGC1-a-dependent myokine that drives brown-fat-like development of white fat and thermogenesis. Nature 2012;481: Chinsomboon J, Ruas J, Gupta RK, et al. The transcriptional coactivator PGC-1alpha mediates exercise-induced angiogenesis in skeletal muscle. Proc Natl Acad Sci U S A 2009;106:

13 diabetes.diabetesjournals.org Mehlem and Associates Zhang K, Lu J, Mori T, et al. Baicalin increases VEGF expression and angiogenesis by activating the ERRalpha/PGC-1alpha pathway. Cardiovasc Res 2011;89: Wallace MA, Hock MB, Hazen BC, Kralli A, Snow RJ, Russell AP. Striated muscle activator of Rho signalling (STARS) is a PGC-1a/oestrogen-related receptor-a target gene and is upregulated in human skeletal muscle after endurance exercise. J Physiol 2011;589: Mootha VK, Lindgren CM, Eriksson KF, et al. PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet 2003;34: Patti ME, Butte AJ, Crunkhorn S, et al. Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: potential role of PGC1 and NRF1. Proc Natl Acad Sci U S A 2003;100: Sun CY, Lee CC, Hsieh MF, Chen CH, Chou KM. Clinical association of circulating VEGF-B levels with hyperlipidemia and target organ damage in type 2 diabetic patients. J Biol Regul Homeost Agents 2014;28: Cheng F, Zhao L, Wu Y, et al. Serum vascular endothelial growth factor B is elevated in women with polycystic ovary syndrome and can be decreased with metformin treatment. Clin Endocrinol (Oxf) 2016;84: Gertow K, Bellanda M, Eriksson P, et al. Genetic and structural evaluation of fatty acid transport protein-4 in relation to markers of the insulin resistance syndrome. J Clin Endocrinol Metab 2004;89: Gómez-Ambrosi J, Catalán V, Rodríguez A, et al. Involvement of serum vascular endothelial growth factor family members in the development of obesity in mice and humans. J Nutr Biochem 2010;21: Gómez-Ambrosi J, Catalán V, Diez-Caballero A, et al. Gene expression profile of omental adipose tissue in human obesity. FASEB J 2004;18: