HIV 1 exploits innate signaling by TLR8 and DC SIGN for productive infection of dendritic cells

Size: px
Start display at page:

Download "HIV 1 exploits innate signaling by TLR8 and DC SIGN for productive infection of dendritic cells"

Transcription

1 HIV 1 exploits innate signaling by TLR8 and DC SIGN for productive infection of dendritic cells Sonja I Gringhuis 1,2*, Michiel van der Vlist 1,2*, Linda M van den Berg 1,2, Jeroen den Dunnen 2,3, Manja Litjens 2 and Teunis B H Geijtenbeek 1,2 1 Center of Infection and Immunity Amsterdam and Center for Experimental and Molecular Medicine, Academic Medical Center, University of Amsterdam, Amsterdam,The Netherlands; 2 Department of Molecular Cell Biology and Immunology, VU University Medical Center, Amsterdam, The Netherlands; 3 Present address: Cell Biology and Histology, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands. * These authors contributed equally to this work. 1

2 Supplementary Figure 1 Supplementary Figure 1 Silencing of Raf-1 in DCs by RNA interference and Raf-1 inhibition by GW5074. (a,b) Silencing of Raf-1 was verified by quantitative real-time PCR or flow cytometry at 72 h after transfection. (c-f) Cell viability and apoptosis after Raf-1 silencing (c,d) or Raf-1 inhibition with GW5074 (e,f) were determined by Cell-Titer Glo assay (c,e) and caspase 3/7 activity (d,f), respectively. Staurosporine (10 μm; Calbiochem) was used as a positive control. Data are presented as mean ± s.d. of four independent experiments (a) or representative for two (c-f) or four (b) independent experiments. 2

3 Supplementary Figure 2 Supplementary Figure 2 HIV-1 LAI induces Raf-1 activation. Raf-1 phosphorylation at Ser338 or Tyr was measured by flow cytometry in unstimulated DCs (thin line) or stimulated for 10 min with HIV-1 LAI in the absence (filled histogram) or presence (thick line) of blocking antibodies. Data are representative for 4 independent experiments. 3

4 Supplementary Figure 3 Supplementary Figure 3 Silencing of MyD88, TLR7 and TLR8 in DCs by RNA interference. (a-d) Silencing of target genes in MyD88-, TLR7-, TLR8- or control-silenced DCs was verified by quantitative real-time PCR or flow cytometry at 72 h after transfection. (e) Functional silencing in TLR7-silenced DCs was verified by stimulation with TLR7- specific ligand R837. Cytokine mrna expression was determined by quantitative real-time PCR after 6 h stimulation. Expression is normalized to GAPDH. Data are presented as mean ± s.d. of two (e) or four (a,c) independent experiments or representative for at least four independent experiments (b,d). 4

5 Supplementary Figure 4 Supplementary Figure 4 Co-infections enhance HIV-1 replication via Raf-1 signaling pathways in myeloid DCs. DC-SIGN + myeloid DCs were co-infected for 6 h with HIV-1 BaL in combination with Mycobacterium tuberculosis or Candida albicans in the presence or absence of Raf-1 inhibitor GW5074 and Tat-Rev mrna was determined by quantitative realtime PCR. mrna expression is normalized to GAPDH. Data are presented as mean ± s.d. of two independent experiments. 5

6 Supplementary Table 1 Expression primer sequences Gene product Forward primer Reverse primer TNF CCATGTTCGTCATGGGTGTG GGTGCTAAGCAGTTGGTGGTG IL-10 GAGGCTACGGCGCTGTCAT CCACGGCCTTGCTCTTGTT IFN-β ACAGACTTACAGGTTACCTCCGAAAC CATCTGCTGGTTGAAGAATGCTT Tat-Rev ATGGCAGGAAGAAGCGGAG ATTCCTTCGGGCCTGTCG Vpu TCTCTCGACGCAGGACTCG TCTGATGAGCTCTTCGTCGC Gag GTGTGGAAAATCTCTAGCAGTGG CGCTCTCGCACCCATCTC GAPDH CCATGTTCGTCATGGGTGTG GGTGCTAAGCAGTTGGTGGTG Abortive HIV-1 RNA GGGTCTCTCTGGTTAGACCAGATC GGTTCCCTAGTTAGCCAGAGAGC 18S TCGAGGCCCTGTAATTGGAA CCCTCCAATGGATCCTCGTT ChIP primer sequences Gene product Forward primer Reverse primer HIV-1 LTR CGAGAGCTGCATCCGGAGTA GAGGCTTAAGCAGTGGGTTCC HIV GACGCAGGACTCGGCTTG TGGCGTACTCACCAGTCGC HIV TGAGGGACAATTGGAGAAGTGA TCTGCACCACTCTTCTCTTTGC HIV AGTTGTCCCCCTAACGGACAC TCCCGAATCCTGCAAAGC HIV GCCTTAGGCATCTCCTATGGC GATGAGCTCTTCGTCGCTGTC GAPDH TACTAGCGGTTTTACGGGCG TCGAACAGGAGGAGCAGAGAGCGA 6

Nature Immunology doi: /ni Supplementary Figure 1. Raf-1 inhibition does not affect TLR4-induced type I IFN responses.

Nature Immunology doi: /ni Supplementary Figure 1. Raf-1 inhibition does not affect TLR4-induced type I IFN responses. Supplementary Figure 1 Raf-1 inhibition does not affect TLR4-induced type I IFN responses. Real-time PCR analyses of IFNB, ISG15, TRIM5, TRIM22 and APOBEC3G mrna in modcs 6 h after stimulation with TLR4

More information

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao

More information

Supporting Information

Supporting Information Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection. Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the

More information

HIV-1 blocks the signaling adaptor MAVS to evade antiviral host defense after sensing of abortive HIV-1 RNA by the host helicase DDX3

HIV-1 blocks the signaling adaptor MAVS to evade antiviral host defense after sensing of abortive HIV-1 RNA by the host helicase DDX3 blocks the signaling adaptor to evade antiviral host defense after sensing of abortive RNA by the host helicase Sonja I Gringhuis, Nina Hertoghs, Tanja M Kaptein, Esther M Zijlstra-Willems, Ramin Sarrami-Forooshani,

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

Salp15 Binding to DC-SIGN Inhibits Cytokine Expression by Impairing both Nucleosome Remodeling and mrna Stabilization

Salp15 Binding to DC-SIGN Inhibits Cytokine Expression by Impairing both Nucleosome Remodeling and mrna Stabilization Salp15 Binding to DC-SIGN Inhibits Cytokine Expression by Impairing both Nucleosome Remodeling and mrna Stabilization Joppe W. R. Hovius 1,2[, Marein A. W. P. de Jong 3[, Jeroen den Dunnen 3, Manja Litjens

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to

Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to Class II tetramer staining Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to PE were combined with dominant HIV epitopes (DRB1*0101-DRFYKTLRAEQASQEV, DRB1*0301- PEKEVLVWKFDSRLAFHH,

More information

Supplementary Data Table of Contents:

Supplementary Data Table of Contents: Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Towards an HIV Cure Pre-Conference Symposium 20 & 21 July 2012

Towards an HIV Cure Pre-Conference Symposium 20 & 21 July 2012 Towards an HIV Cure Pre-Conference Symposium 20 & 21 July 2012 Your logo Natural control of HIV infection is associated with an isotype switched IgG antibody response to HIV Gag antigens in patients with

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji

More information

IMO-8400, a novel TLR7, TLR8 and TLR9 antagonist, psoriasis

IMO-8400, a novel TLR7, TLR8 and TLR9 antagonist, psoriasis IMO-8400, a novel TLR7, TLR8 and TLR9 antagonist, inhibits disease development in mouse models of psoriasis Weiwen e Ja Jiang, Fu-Gang Zhu, Dong Yu, Ekambar R. Kandimalla, a a, Nicola La Monica, and Sudhir

More information

Supplementary Information

Supplementary Information Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.

Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 13: Mechanisms of Immunity to Viral Disease Prepared by

More information

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists

Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists of: (i) the YPet domain (an enhanced YFP); (ii) the

More information

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence

More information

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used

More information

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed

More information

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1 1 Supporting Information 2 3 4 Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene induction necessitates canonical NF-κB activation through TBK1 5 6 Authors: Abe et al. 7 8 9 Supporting

More information

A TOLLIP DEFICIENCY ALLELE, RS , IS ASSOCIATED WITH LNCRNA TOLLIP-AS1 EXPRESSION, T-CELL MEMORY PHENOTYPE, AND INCREASED TB SUSCEPTIBILITY

A TOLLIP DEFICIENCY ALLELE, RS , IS ASSOCIATED WITH LNCRNA TOLLIP-AS1 EXPRESSION, T-CELL MEMORY PHENOTYPE, AND INCREASED TB SUSCEPTIBILITY A TOLLIP DEFICIENCY ALLELE, RS5743854, IS ASSOCIATED WITH LNCRNA TOLLIP-AS EXPRESSION, T-CELL MEMORY PHENOTYPE, AND INCREASED TB SUSCEPTIBILITY February 2, 208 5th Global Forum on TB Vaccines MULTIPLE

More information

NK cells promote neutrophil recruitment in the brain during sepsisinduced. neuroinflammation

NK cells promote neutrophil recruitment in the brain during sepsisinduced. neuroinflammation NK cells promote neutrophil recruitment in the brain during sepsisinduced neuroinflammation Hao He 1, Tingting Geng 1, Piyun Chen 1, Meixiang Wang 1, Jingxia Hu 1, Li Kang 1, Wengang Song 1, * & Hua Tang

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta

More information

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

Intrinsic cellular defenses against virus infection

Intrinsic cellular defenses against virus infection Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses

More information

Lecture on Innate Immunity and Inflammation

Lecture on Innate Immunity and Inflammation Lecture on Innate Immunity and Inflammation Evolutionary View Epithelial barriers to infection Four main types of innate recognition molecules:tlrs, CLRs, NLRs, RLRs NF-κB, the master transcriptional regulator

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Involvement of TLR4/STAT3 signaling in the antimelanoma effects of atractylenolide II. Fu Xiuqiong

Involvement of TLR4/STAT3 signaling in the antimelanoma effects of atractylenolide II. Fu Xiuqiong Involvement of TLR4/STAT3 signaling in the antimelanoma effects of atractylenolide II Fu Xiuqiong Melanoma fact Skin cancers Skin cancer deaths 2.3% 75% Melanoma Non-melanoma skin cancers ----American

More information

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

Supporting Information

Supporting Information Supporting Information Sui et al..7/pnas.997 Pre-CLP CM9 LA9 SL Tat# Pol Vif % Tetramer + CD + CD + Vac+IL- +IL- Vac Fig. S. Frequencies of six different CD + CD + Mamu-A*-tetramer + cells were measured

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF

The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong

More information

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9! Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain

More information

Transduction of lentivirus to human primary CD4+ T cells

Transduction of lentivirus to human primary CD4+ T cells Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from

More information

4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.

4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation. List of supplemental information 1. Graph of mouse weight loss during course of infection- Line graphs showing mouse weight data during course of infection days 1 to 10 post-infections (p.i.). 2. Graph

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Supplementary Information

Supplementary Information Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara

More information

How HIV Causes Disease Prof. Bruce D. Walker

How HIV Causes Disease Prof. Bruce D. Walker How HIV Causes Disease Howard Hughes Medical Institute Massachusetts General Hospital Harvard Medical School 1 The global AIDS crisis 60 million infections 20 million deaths 2 3 The screen versions of

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- 1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated

More information

Impact of TLR7/8 Triggering on HIV Pathogenesis

Impact of TLR7/8 Triggering on HIV Pathogenesis University Hospital Zurich u Division of Infectious Diseases and Hospital Epidemiology Impact of TLR7/8 Triggering on HIV Pathogenesis Roberto F. Speck, MD Hallmark of HIV-Infection is the Progressive

More information

Supplementary Figures

Supplementary Figures MiR-29 controls innate and adaptive immune responses against intracellular bacterial infection by targeting IFN-γ Feng Ma 1,2,5, Sheng Xu 1,5, Xingguang Liu 1, Qian Zhang 1, Xiongfei Xu 1, Mofang Liu 3,

More information

A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis

A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis Mourad Matmati 1,2 *, Peggy Jacques 3 *, Jonathan Maelfait 1,2, Eveline Verheugen 3, Mirjam Kool

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

More information

Supplementary Information File

Supplementary Information File Supplementary Information File Supplementary Table 1. List of synthesized sirna sequences for target genes sirna Species Sequence Ctrl sirna mouse sense 5 -UUCUCCGAACGUGUCACGUTT-3 Antisense 5 -ACGUGACACGUUCGGAGAATT-3

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION sirna pool: Control Tetherin -HA-GFP HA-Tetherin -Tubulin Supplementary Figure S1. Knockdown of HA-tagged tetherin expression by tetherin specific sirnas. HeLa cells were cotransfected with plasmids expressing

More information

UvA-DARE (Digital Academic Repository) Tick-host-pathogen interactions in Lyme borreliosis Hovius, J.W.R. Link to publication

UvA-DARE (Digital Academic Repository) Tick-host-pathogen interactions in Lyme borreliosis Hovius, J.W.R. Link to publication UvA-DARE (Digital Academic Repository) Tick-host-pathogen interactions in Lyme borreliosis Hovius, J.W.R. Link to publication Citation for published version (APA): Hovius, J. W. R. (2009). Tick-host-pathogen

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G

More information

Fungal Engagement of the C-Type Lectin Mincle Suppresses Dectin-1-Induced Antifungal Immunity

Fungal Engagement of the C-Type Lectin Mincle Suppresses Dectin-1-Induced Antifungal Immunity Article Fungal Engagement of the C-Type Lectin Mincle Suppresses Dectin-1-Induced Antifungal Immunity Brigitte A. Wevers, 1 Tanja M. Kaptein, 1 Esther M. Zijlstra-Willems, 1 Bart Theelen, 2 Teun Boekhout,

More information

Cell-mediated Immunity

Cell-mediated Immunity Cellular & Molecular Immunology Cell-mediated Immunity Nicholas M. Ponzio, Ph.D. Department of Pathology & Laboratory Medicine April 6, 2009 Today s Presentation: Overview Cellular Interactions In Humoral

More information

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p. a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure

More information

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or

More information

Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al.

Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al. Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al. a. 12 14 Relative apob mrna (%) 8 6 4 2 Relative apob mrna (%) 12 8 6 4 2 5

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human

More information

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 + F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/366/ra25/dc1 Supplementary Materials for Viral entry route determines how human plasmacytoid dendritic cells produce type I interferons Daniela Bruni, Maxime

More information

Citation for published version (APA): Von Eije, K. J. (2009). RNAi based gene therapy for HIV-1, from bench to bedside

Citation for published version (APA): Von Eije, K. J. (2009). RNAi based gene therapy for HIV-1, from bench to bedside UvA-DARE (Digital Academic Repository) RNAi based gene therapy for HIV-1, from bench to bedside Von Eije, K.J. Link to publication Citation for published version (APA): Von Eije, K. J. (2009). RNAi based

More information

Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).

Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary

More information

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function. ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina

More information

Protein extraction and western blot analysis Protein extraction was performed as

Protein extraction and western blot analysis Protein extraction was performed as ESM Methods Protein extraction and western blot analysis Protein extraction was performed as previously described [1]. 2 g protein was loaded on SDSPAGE and immunoblotted with antibodies to mouse AKT (1:1,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells

More information

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of

More information

Supporting Information

Supporting Information Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were

More information

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23 3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF

More information

Standardization of Immune Biomarkers: Lessons From the HIV Field

Standardization of Immune Biomarkers: Lessons From the HIV Field Standardization of Immune Biomarkers: Lessons From the HIV Field Alan Landay, PhD Rush University Medical Center Thomas Denny, MSc Duke University Medical Center and Viral Load Standardization Immunology

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/381/ra59/dc1 Supplementary Materials for Analysis of single-cell cytokine secretion reveals a role for paracrine signaling in coordinating macrophage responses

More information

EGFR kinase activity is required for TLR4 signaling and the septic shock response

EGFR kinase activity is required for TLR4 signaling and the septic shock response Manuscript EMBOR-2015-40337 EGFR kinase activity is required for TLR4 signaling and the septic shock response Saurabh Chattopadhyay, Manoj Veleeparambil, Darshana Poddar, Samar Abdulkhalek, Sudip K. Bandyopadhyay,

More information

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent

More information

Oncolytic Viruses as a Potential Approach to Eliminate the HIV Reservoir

Oncolytic Viruses as a Potential Approach to Eliminate the HIV Reservoir Oncolytic Viruses as a Potential Approach to Eliminate the HIV Reservoir Costiniuk CT, Côté SC, Al-Ghazawi FM, Carrasco-Medina L,Young CD, & Angel JB University of Ottawa, November 12 th, 2012 HIV Reservoirs

More information