HIF prolyl 4-hydroxylase-2 inhibition improves glucose and lipid metabolism and protects. against obesity and metabolic dysfunction

Transcription

1 Page 1 of 42 Diabetes HIF prolyl 4-hydroxylase-2 inhibition improves glucose and lipid metabolism and protects against obesity and metabolic dysfunction Running title: HIF-P4H-2 in obesity and metabolism Lea Rahtu-Korpela 1, Sara Karsikas 1, Sohvi Hörkkö 2, Roberto Blanco Sequeiros 3, Eveliina Lammentausta 3, Kari A. Mäkelä 4, Karl-Heinz Herzig 4, Gail Walkinshaw 5, Kari I. Kivirikko 1, Johanna Myllyharju 1, Raisa Serpi 1 and Peppi Koivunen 1 1 Biocenter Oulu, Faculty of Biochemistry and Molecular Medicine, Oulu Center for Cell-Matrix Research, University of Oulu, FIN Oulu, Finland; 2 Nordlab Oulu, Oulu University Hospital, FIN-90220, Oulu, Finland, Department of Medical Microbiology and Immunology, Medical Research Center, University of Oulu, FIN Oulu, Finland; 3 Department of Radiology, Oulu University Hospital and University of Oulu, FIN Oulu, Finland; 4 Biocenter Oulu, Department of Physiology, University of Oulu, FIN Oulu, Finland; 5 FibroGen Inc., San Francisco, CA 94158, USA Corresponding author: Peppi Koivunen, peppi.koivunen@oulu.fi Diabetes Publish Ahead of Print, published online May 1, 2014

2 Diabetes Page 2 of 42 Abstract Obesity is a major public health problem predisposing subjects to metabolic syndrome, type 2 diabetes and cardiovascular diseases. Specific prolyl 4-hydroxylases (P4Hs) regulate the stability of the hypoxia-inducible factor (HIF), a potent governor of metabolism, isoenzyme 2 being the main regulator. We investigated here whether HIF-P4H-2 inhibition could be used to treat obesity and its consequences. Hif-p4h-2-deficient mice, whether fed normal chow or a high-fat diet, had less adipose tissue, smaller adipocytes and less adipose tissue inflammation than their littermates. They also had improved glucose tolerance and insulin sensitivity. The mrna levels of the HIF-1 targets glucose transporters, glycolytic enzymes and pyruvate dehydrogenase kinase-1 were increased in their tissues, while acetyl-coa concentration was decreased. The hepatic mrna level of the HIF-2 target insulin receptor substrate-2 was higher, while those of two key enzymes of fatty acid synthesis were lowered. Serum cholesterol levels and de novo lipid synthesis were decreased and the mice were protected against hepatic steatosis. Oral administration of a HIF-P4H inhibitor, FG-4497, to wild-type mice with a metabolic dysfunction phenocopied these beneficial effects. HIF-P4H-2 inhibition may be a novel therapy that not only protects against the development of obesity and its consequences but also reverses these conditions. 2

3 Page 3 of 42 Diabetes Hypoxia-inducible factor (HIF) regulates the expression of numerous hypoxia-regulated genes (1-3). The HIF-α subunit isoforms HIF-1α and HIF-2α are synthesized constitutively, and hydroxylation of two critical prolines generates 4-hydroxyproline residues which target HIF-α for degradation in normoxia. In hypoxia, this hydroxylation is inhibited, so that HIF-α evades degradation and forma functional dimer with HIF-β (1-3). The hydroxylation of HIF-α is catalyzed by three HIF prolyl 4-hydroxylase isoenzymes (HIF-P4Hs 1-3, also known as PHDs 1-3 and EglNs 2, 1, and 3) (1-6) and a transmembrane P4H-TM (3, 7), HIF-P4H-2 being the main oxygen sensor in the HIF pathway (1-3). Hif-p4h-2 null mice die during embryonic development, whereas Hif-p4h-1 and Hif-p4h-3 null mice are viable (8). Broad-spectrum conditional Hif-p4h-2 inactivation leads to severe erythrocytosis, hyperactive angiogenesis and dilated cardiomyopathy (3, 9, 10). We have generated Hif-p4h-2 hypomorphic mice (Hif-p4h-2 gt/gt ) that express decreased amounts of wild-type Hif-p4h-2 mrna and show stabilization of Hif-αs (11). These mice appear healthy and have a normal lifespan. They have no increased erythrocytosis and show no signs of hyperactive angiogenesis or dilated cardiomyopathy, but are instead protected against myocardial infarction and ischemiareperfusion injury (11, 12). Many studies have demonstrated that hypoxia reduces body weight (13-15). The only obvious abnormality found in the Hif-p4h-2 gt/gt mice was that their weights were 85-90% of those of the wild type (11). We focused here initially on this difference and found that these mice have less adipose tissue than their littermates. This finding promoted us to study their lipid and glucose metabolism, especially as obesity is a major public health problem and increases the risk of metabolic syndrome, type 2 diabetes and cardiovascular diseases. Our data show that the Hifp4h-2 gt/gt mice, whether fed normal chow or a high-fat diet, have major alterations in their adipose tissues and metabolism including improved glucose tolerance and insulin sensitivity, reduced serum cholesterol levels and protection against hepatic steatosis. Small-molecule HIF-P4H inhibitors have been developed for the treatment of e.g. anemias and ischemic diseases (3). Our Hif-p4h-2 gt/gt mice data suggested that pharmacological 3

4 Diabetes Page 4 of 42 HIF-P4H-2 inhibition could also be beneficial for the treatment of obesity and metabolic syndrome. We therefore administered to wild-type mice with a metabolic dysfunction FG-4497, which stabilizes HIF-α in cultured cells and in vivo and increases erythropoiesis in animals with no apparent toxicity (3, 16, 17). Our data demonstrate that its administration phenocopied the beneficial effects of genetic HIF-P4H-2 deficiency on adipose tissues and metabolism. RESEARCH DESIGN AND METHODS Animal Experiments Generation of C57BL/6 Hif-p4h-2 gt/gt mice has been described (11). All experiments were performed according to protocols approved by the Provincial State Office of Southern Finland. All data obtained with the Hif-p4h-2 gt/gt mice were compared to those of their wild-type littermates. The mice were fed a standard rodent diet or a high fat diet (HFD) (18% and 42% kcal fat, respectively, T.2018C.12 and TD88137, Harlan Teklad). FG-4497 was dissolved in 0.5% NaCMC (Spectrum) and 0.1% Polysorbate 80 (Fluka), and the solvent was also used as a vehicle, and both were administered orally to C57BL/6 mice. Histological Analyses Five-µm sections of formaldehyde-fixed paraffin-enmbedded tissue samples were stained with hematoxylin-eosin (HE) and viewed and photographed with Leica DM LB2 microscope and Leica DFC 320 camera or Nikon Eclipse 50i microscope and DS-5M-L2 camera. Representative pictures, 5-8 per mouse, were taken and the area of 100 adipocytes was quantified using Nikon NIS-Elements BR Macrophage infiltration was analyzed by an anti-cd68 antibody (ab955, Abcam) and EnVision Detection System (Dako). The number of macrophage aggregates was 4

5 Page 5 of 42 Diabetes calculated from 5-8 fields/sample. Hepatic steatosis was scored ( ) from HE-stained sections. Western Blotting NE-PER extraction reagents (Thermo Scientific) were used to prepare nuclear fractions. Samples of µg were resolved by SDS-PAGE, blotted and probed with primary antibodies: Hif-1α (NB , Novus), Hif-2α (ab199, Abcam) and β-actin (NB , Novus). qpcr Analyses Total RNA from tissues was isolated with EZNA total RNA kit II (OMEGA Bio-tek) or TriPure isolation reagent (Roche Applied Science) and reverse transcripted with an iscript cdna synthesis kit (Bio-Rad). qpcr was performed with itaq SYBR Green Supermix and ROX (Bio- Rad) in a Stratagene MX3005 thermocycler or C1000 Touch Thermal Cycler and CFX96 Real- Time System (Bio-Rad) with the primers shown in Supplementary Table S1. MRI Imaging and Analysis Tissue fat content was determined using the 3-point Dixon method and a 3 Tesla clinical scanner (Skyra, Siemens, Erlangen). The sequence used was T1 TSE Dixon (Field of View 320x320, TR 720, TE 20, 24 slices). The torso of the animal was scanned, and the region of interest was drawn to separate the regional volume of subcutaneous fat for possible correlation with other variables. Glucose and Insulin Tolerance Tests and Deoxyglucose Uptake Test 5

6 Diabetes Page 6 of 42 Glucose tolerance test (GTT) and insulin tolerance test (ITT) were performed on mice fasted for 6-12 h and anesthetized with fentanyl/fluanisone and midazolam. For GTT, mice were injected intraperitoneally with 1 mg/g glucose and blood glucose concentrations were monitored with a glucometer. Serum insulin values were determined with Rat/Mouse Insulin ELISA kit (EZRMI- 13K, Millipore), and homeostasis model assessment-insulin resistance (HOMA-IR) scores were calculated from the glucose and insulin values. For ITT, mice were injected intraperitoneally with 1 IU/kg insulin (Humulin Regular, Lilly) and blood glucose concentrations were determined as above. For deoxyglucose uptake test, mice were injected intraperitoneally with 0.6 µci/g of 14 C-deoxyglucose (Perkin Elmer) combined with 1 mg/g glucose and sacrificed 60 min later. 50- µg pieces of tissues and 50-µl blood samples were homogenized in 1:1, or in the case of WAT 2:1, chloroform:methanol and centrifuged. The pellet was re-extracted, the supernatants were combined and scintillated for 14 C activity. Determination of Serum Lipids Serum total cholesterol, HDL cholesterol and triglyceride levels were determined by an enzymatic method (Roche Diagnostics). The Friedewald equation (18) was used to calculate LDL+VLDL cholesterol concentrations. Determination of Tissue Acetyl-CoA Concentration Snap frozen tissues were homogenized in precooled 8% perchloric acid in 40% (v/v) ethanol and centrifuged. The supernatant was neutralized and amount of acetyl-coa was measured with PicoProbe Acetyl CoA assay kit (ab87546, Abcam). 6

7 Page 7 of 42 Diabetes Lipogenesis Analysis Mice were terminally anesthetized with fentanyl/fluanisone and midazolam and ~30 mg pieces of WAT and liver were excised and incubated for 90 min at 37 C with 40 µci of [ 14 C]acetate (Perkin Elmer) in Dulbecco s MEM pregassed with 95% O 2 and 5% CO 2. Lipids were extracted after saponification and scintillated for 14 C activity (19). Statistical Analyses Student s two-tailed t-test was used for comparisons between two groups and t-test for paired samples for pairwise testing. Fisher s exact test was used to calculate significance for the difference between genotypes in liver steatosis analyses. Areas under the curve (AUC) were calculated by the method of summary measures. All data are shown as mean ± SEM. P-values below 0.05 were considered statistically significant. RESULTS Hif-p4h-2 gt/gt Mice Are Lighter Than Their Littermates in Spite of No Alterations in Food Intake and Physical Activity Hif-p4h-2 gt/gt mice have their Hif-p4h-2 gene disrupted by a GeneTrap insertion cassette. Small amounts of wild-type Hif-p4h-2 mrna were nevertheless generated from the gene-trapped alleles (11), its smallest relative amounts in the Hif-p4h-2 gt/gt tissues studied being found in the heart and skeletal muscle, while the highest proportion was found in the liver (11). We analyzed these values in the skeletal muscle and liver of the mice used here and found that the relative proportions of wild-type Hif-p4h-2 mrna in these Hif-p4h-2 gt/gt tissues were ~25% and ~60%, respectively (Supplementary Fig. 1A). We have found previously that the amounts of Hif-p4h-2 protein in the Hif-ph4-2 gt/gt skeletal muscle, heart and kidney correspond to those of the wild- 7

8 Diabetes Page 8 of 42 type mrna (11). Hif-1α was well stabilized in the heart and weakly stabilized in the skeletal muscle and kidney of the Hif-p4h-2 gt/gt mice, while Hif-2α was weakly stabilized in their heart and skeletal muscle (11). We now also found a weak stabilization of Hif-2α, but not Hif-1α, in the Hif-p4h-2 gt/gt liver with a more sensitive antibody (Fig. 1A). The weight of 5-week-old Hif-p4h-2 gt/gt mice fed normal chow (18% kcal fat) was lower than that of their wild-type littermates, and the Hif-p4h-2 gt/gt mice also gained less weight during the subsequent 10 weeks (Fig. 1B). The weight difference persisted later, the weight of 1-yearold Hif-p4h-2 gt/gt mice being 80-85% of those of the wild type (Fig. 1B). No difference was found between the genotypes in the lengths of the tibiae or the weight of the liver relative to the tibia length (Supplementary Fig. 1B). No difference was found in the amount of food intake between the Hif-p4h-2 gt/gt and wildtype mice in metabolic home cage analyses whether expressed per mouse or body weight and no difference was found in the physical activity between these mice, either (Supplementary Fig. 2). There was a trend for increased O 2 consumption and CO 2 production when expressed per body weight in the Hif-p4h-2 gt/gt mice, but this reached statistical significance only in the case of O 2 consumption in the dark, with no difference in respiratory exchange ratio between the genotypes (Supplementary Fig. 2). Hif-p4h-2 gt/gt Mice Have Less Adipose Tissue and Smaller Adipocytes The amount of gonadal white adipose tissue (WAT) in the Hif-p4h-2 gt/gt mice, expressed relative to tibia length to correct for body weight differences, was half of that in the wild-type littermates (Fig. 1C). Furthermore, the adipocytes in the Hif-p4h-2 gt/gt WAT were smaller (Fig. 1D) and the amount of wild-type Hif-p4h-2 mrna in the Hif-p4h-2 gt/gt WAT was ~50% of that in the wildtype tissue (Supplementary Fig. 1A). The amount of Hif-p4h-2 protein in the Hif-p4h-2 gt/gt WAT was correspondingly reduced (Supplementary Fig. 1C) and its Hif-1α, but not Hif-2α, was stabilized to a low extent (Fig. 1A). The weight of the brown adipose tissue (BAT) was likewise reduced (Fig. 1E) and the wild-type Hif-p4h-2 mrna level in the Hif-p4h-2 gt/gt BAT was only 8

9 Page 9 of 42 Diabetes ~10% of that in the wild-type tissue (Supplementary Fig. 1A). No difference in the mrna level of uncoupling protein 1 (Ucp1) was found between the Hif-p4h-2 gt/gt and wild-type BAT (Supplementary Fig. 1D). MRI analyses of live anesthetized mice indicated that the amount of subcutaneous fat was also reduced in the Hif-p4h-2 gt/gt mice (Fig. 1F). Hif-p4h-2 gt/gt Mice Have Reduced Number of Adipose Tissue Macrophage Aggregates Obesity is associated with chronic adipose tissue inflammation and formation of macrophage aggregates around adipocytes (20, 21). Chronic 21-day hypoxia decreased the number of such aggregates in 1-year-old mice (15). We found here that their number is significantly lower in the WAT of 1-year-old Hif-p4h-2 gt/gt than wild-type mice (Fig. 1G). As in the mice subjected to chronic hypoxia (15), an increased adiponectin mrna level and decreased leptin and chemochine (C-C motif) ligand 2 mrna levels were found in the Hif-p4h-2 gt/gt WAT (Supplementary Fig. 3A) while no increase was seen in serum adiponectin level, but serum leptin level was decreased (Supplementary Fig. 3B). Hif-p4h-2 gt/gt Mice Have Reduced Serum Cholesterol Levels and Are Protected against Hepatic Steatosis The levels of serum total cholesterol and HDL and LDL+VLDL cholesterol were lower in the Hif-p4h-2 gt/gt mice than in the wild type, the HDL/LDL+VLDL ratio being increased, while the triglyceride level was not altered significantly (Fig. 2A). Livers of 1-year-old wild-type mice had steatosis, even though these mice were not on any HFD, whereas the Hif-p4h-2 gt/gt mice were protected against its development (Fig. 2B). Hif-p4h-2 gt/gt Mice Have Improved Glucose Tolerance and Insulin Sensitivity The glucose tolerance of 1-year-old Hif-p4h-2 gt/gt mice was markedly better than that of their littermates and even the fasting blood glucose levels (at 0 min) were significantly lower than in the wild type (Fig. 3A and S4A). The fasting serum insulin levels and HOMA-IR scores were 9

10 Diabetes Page 10 of 42 likewise lower, indicating that the lower blood glucose levels were due to increased insulin sensitivity (Fig. 3B and S4B). A similar, though less marked, difference in glucose tolerance was seen between the genotypes in 4-5-month-old mice (Fig. 3A).Correspondingly, 3-4-month-old Hif-p4h-2 gt/gt mice had lower blood glucose levels than wild-type mice in an insulin tolerance test (Fig. 3C). To learn which Hif-p4h-2 gt/gt tissues were responsible for the increased glucose intake, we studied the uptake of 14 C-deoxyglucose in fasting mice and found an increased uptake relative to the wild type in the skeletal muscle (Fig. 3D). Wild-type, But Not Hif-p4h-2 gt/gt Mice, Develop Metabolic Dysfunction with Age Comparison of data between 1-year-old and 4-5-month-old wild-type mice indicated that the former had larger adipocytes, larger number of adipose tissue macrophage aggregates, increased fasting blood glucose and serum insulin levels and larger HOMA-IR scores, while none of these were significantly different between 1-year-old and 4-5-month-old Hif-p4h-2 gt/gt mice (Fig. 4A- E). The 1-year-old wild-type mice thus had a relative insulin resistance and metabolic dysfunction compared to the younger mice whereas the Hif-p4h-2 gt/gt mice were protected against their development. Hif-p4h-2 gt/gt Mice Have Altered Expression of Glucose and Lipid Metabolism Genes The mrna levels of the HIF-1α targets Glut1 and several enzymes of glycolysis (22) were increased in the Hif-p4h-2 gt/gt skeletal muscle and WAT (Fig. 5A and B), but not in the Hif-p4h- 2 gt/gt liver (Supplementary Fig. 5A). The mrna level of the glucose-regulated Glut2 (23) was lower in the liver of the Hif-p4h-2 gt/gt mice than in the wild type, presumably due to their improved glucose tolerance, while the mrna level of the insulin-regulated Glut4 (24) was higher in the skeletal muscle and WAT of the Hif-p4h-2 gt/gt mice, probably due to their increased insulin sensitivity (Fig. 5A and B). The mrna level of the HIF-1α target Pdk1, which inhibits pyruvate dehydrogenase activity (22), was increased in the Hif-p4h-2 gt/gt skeletal muscle and WAT (Fig. 5A). The Pparγ mrna level was likewise increased in the Hif-p4h-2 gt/gt skeletal 10

11 Page 11 of 42 Diabetes muscle and WAT (Fig. 5A), this change being similar to that seen in the WAT of mice with adipocyte-specific Hif-p4h-2 deletion (25), while the Pparα mrna level was slightly decreased in the Hif-p4h-2 gt/gt liver (Fig. 5B). The mrna levels of the lipolysis markers Lipe and Pnpla2 were increased in the Hif-p4h-2 gt/gt WAT (Fig. 5A) suggesting that an increased lipolysis may have contributed to the decreased amount of WAT in these mice. The mrna levels of Srebp1c, which regulates lipogenesis and fatty acid synthesis, and its targets Accα and Fas, enzymes of fatty acid synthesis, were lower in the Hif-p4h-2 gt/gt liver, while the mrna level of the Ldl receptor was similar in the Hif-p4h-2 gt/gt and wild-type livers (Fig. 5B). The mrna level of the HIF-2α target (26) Irs-2, which regulates Srepb1c and hepatic lipid accumulation (27), was increased in the Hif-p4h-2 gt/gt liver, whereas the mrna level of Irs-1 was not altered (Fig. 5B). To study, whether the increased mrna levels led to increased protein levels, we analyzed Glut4, Gadph and Pdk1 in WAT by Western blotting and found increased levels of all three proteins in the Hif-p4h-2 gt/gt WAT (Supplementary Fig. 5B). Hif-p4h-2 gt/ gt Mice Have Reduced Acetyl-CoA Levels and De Novo Lipogenesis To study whether the presumed decreased conversion of pyruvate to acetyl-coa due to an increased Pdk1 expression actually decreased the amount of acetyl-coa, we measured its amount in skeletal muscle, WAT and liver and found a decreased concentration in all three Hifp4h-2 gt/gt tissues (Fig. 5C). We also studied whether the decreased Accα and Fas mrna and acetyl-coa levels decreased de novo lipogenesis by incubating fresh tissue slices with [ 14 C]acetate and measuring the incorporation of radioactivity into extractable lipids and found a decreased lipogenesis in the Hif-p4h-2 gt/gt WAT (P = 0.03) and liver (P = 0.06) (Fig. 5D). Hif-p4h-2 gt/gt Mice Are Protected Against High-Fat Diet-Induced Metabolic Changes and Steatosis To study, whether Hif-p4h-2 gt/gt mice are protected against obesity-induced changes in glucose metabolism, 6-month-old mice were fed a high-fat diet (HFD, 42% kcal fat) for 6 weeks. The 11

12 Diabetes Page 12 of 42 weight gain of the Hif-p4h-2 gt/gt and wild-type mice during the HFD treatment was similar, the Hif-p4h-2 gt/gt mice thus remaining lighter than their littermates (Fig. 6A). The adipocytes were smaller and the number of macrophage aggregates was lower in the Hif-p4h-2 gt/gt than wild-type WAT (Fig. 6B and C, and Supplementary Fig. 6A). The glucose tolerance of the HFD-fed Hifp4h-2 gt/gt mice was better than that of the HFD-fed wild-type mice, and their fasting blood glucose levels (at 0 min) were likewise lower (Fig. 6D), whereas the lower serum insulin values (by 15%) and HOMA-IR scores (by 36%) in the HFD-fed Hif-p4h-2 gt/gt mice were not statistically significant (Supplementary Fig. 6B). Livers of all the 6-month-old HFD-treated wildtype mice had steatosis (Fig. 6E), 4 of the 9 having a steatosis score ++++, whereas only 4 of the 8 Hif-p4h-2 gt/gt mice had steatosis (P = 0.03) and only one of these 8 had a score +++ and none had The Hif-p4h-2 gt/gt mice were thus protected against the development of a HFD induced hepatic steatosis. Pharmacological Hif-p4h Inhibition Reverses Metabolic Dysfunction Both in Aged Wildtype Mice and in Mice Fed a High Fat Diet FG-4497 inhibits all three HIF-P4Hs competitively with respect to 2-oxoglutarate, with similar IC 50 values (7). We studied whether its oral administration can be used to reverse metabolic dysfunction in two models: (i) 1-year-old wild-type mice fed normal chow that were shown to have metabolic dysfunction (Fig. 4) and (ii) 3.5-month-old wild-type mice fed HFD for 6 weeks before the FG-4497 administration of 60 mg/kg on days 1, 3 and 5 of each week was begun (7). This FG-4497 dose stabilizes Hif-1α and Hif-2α in the mouse kidney and liver and increases serum Epo concentration about 6-fold (7). FG-4497 administration to 1-year-old mice fed normal chow reduced their weight, after a 1-week adjustment period, during the subsequent 5 weeks by ~1.3 g, whereas the vehicle-treated controls gained ~0.6 g (Fig. 7A). The adipocytes were smaller and the number of macrophage 12

13 Page 13 of 42 Diabetes aggregates was lower in the WAT of the FG-4497-treated than vehicle-treated mice (Fig. 7B and C). The serum total cholesterol level and the HDL and LDL + VLDL cholesterol levels of the FG-4497-treated mice were significantly decreased, while their HDL/LDL + VLDL ratio was increased (Fig. 7D). The fasting blood glucose levels of the FG-4497-treated mice were likewise decreased, whereas the decreases in the serum insulin level by ~25% and HOMA-IR score by ~75% (Fig. 7E) were not statistically significant (P = 0.11 in both cases). In the other model 2-month-old mice were fed normal chow or HFD for 6 weeks, after which the mice fed normal chow were given vehicle and those fed HFD were given either HFD and vehicle or HFD and FG-4497 for 4 weeks. During the initial 6-week period the HFD-fed mice gained more weight than those on normal chow (Fig. 7F). The FG-4497 treatment decreased the weight of the HFD-fed mice by ~0.6 g, whereas their vehicle-treated controls gained ~3.0 g (Fig. 7F, FG-4497 vs. vehicle mice P = 0.02). The WAT weight of the FG treated HFD mice was lower than that of their controls (Fig. 7G). The glucose tolerance of the FG-4497-treated HFD mice was better than that of their vehicle-treated controls (Fig. 7H), and their fasting serum insulin levels and HOMA-IR scores were also significantly decreased (Fig. 7I). DISCUSSION Our data indicate that Hif-p4h-2 gt/gt mice, whether fed normal chow or HFD, have less adipose tissue, smaller adipocytes, decreased number of adipose tissue macrophage aggregates and lower serum cholesterol levels than their littermates. They are also protected against hepatic steatosis and show increased glucose tolerance and insulin sensitivity. 13

14 Diabetes Page 14 of 42 The Hif-p4h-2 gt/gt mice had higher levels of glucose transporters and glycolysis enzymes in their skeletal muscle and WAT, similar higher levels having previously been found in their heart (11). Uptake of deoxyglucose to the skeletal muscle was also increased. Furthermore, Pdk1 expression was increased in the Hif-p4h-2 gt/gt skeletal muscle and WAT, as has also been found in the Hif-p4h-2 gt/gt heart (11). A higher Pdk1 level may further increase glycolysis by inhibiting the entry of pyruvate into the citric acid cycle (22). It thus seems evident that glycolysis is increased in several Hif-p4h-2 gt/gt tissues contributing to the overall improved glucose tolerance (Supplementary Fig. 7). These changes agree with the established consequences of the stabilization of HIF-1α (22). HIF-P4Hs 1 and 3 have been reported to also have enzyme-specific substrates other than HIF-1α and HIF-2α (1-3), and thus changes in the levels of those two enzymes may also influence HIF-independent pathways. Such substrates have so far not been identified for HIF-P4H-2, and it therefore seems likely that most, if not all, of the metabolic changes found in the Hif-p4h-2 gt/gt mice were mediated by Hif-α. Obesity is associated with a chronic low-grade inflammation that predisposes to insulin resistance. Adipose tissue macrophages are believed to play a key role in the obesity-induced insulin resistance (20, 21). They infiltrate obese adipose tissue and along with the hypertrophied adipocytes release cytokines and adipokines that contribute to the pro-inflammatory response (20). Macrophage-derived pro-inflammatory factors block insulin action in adipocytes by downregulating the expression of the insulin-regulated GLUT4 and impairing insulin-stimulated GLUT4 transport to the plasma membrane (20). As we found decreased size of adipocytes, reduced number of adipose tissue macrophages and increased Glut4 expression in the Hif-p4h- 2 gt/gt mice, it seems very likely that these changes contribute to their increased insulin sensitivity (Supplementary Fig. 7). 14

15 Page 15 of 42 Diabetes Increased expression of the Hif-2α target Irs-2 in the liver of mice with acute hepatic Hifp4h-3 deletion was accompanied by a decreased Srebp1c expression (26). Our results indicating weak stabilization of Hif-2α, increased expression of Irs-2 and decreased expression of Srebp1c and its targets Accα and Fas in the Hif-p4h-2 gt/gt liver agree with those data. These changes are probably responsible for the decreased fatty acid synthesis and de novo lipogenesis found in the Hif-p4h-2 gt/gt liver and WAT. The lack of acetyl-coa in Hif-p4h-2 gt/gt tissues, which is presumably due to pyruvate dehydrogenase inhibition, is likely to contribute to the decreased lipogenesis (Supplementary Fig. 7). Extensive liver-specific stabilization of Hif-2α leads to hepatic steatosis (26, 28). However, our Hif-p4h-2 gt/gt mice showed no steatosis, but were instead protected against it. Liver-specific stabilization of Hif-2α by acute Hif-p4h-3 deletion likewise did not lead to hepatic steatosis, the data suggesting that low-level hepatic Hif-2α stabilization, as found here in the Hifp4h-2 gt/gt mice, has beneficial effects whereas extensive hepatic Hif-2α stabilization leads to steatosis (26, 28). Liver-specific stabilization of Hif-1α and Hif-2α appears to have no effect on hepatic cholesterol synthesis or intestinal cholesterol absorption, but extensive liver-specific Hif-2α stabilization increases hepatic and serum cholesterol levels (28, 29) due to a decreased cholesterol oxidation to bile acids (29). However, the Hif-p4h-2 gt/gt mice with a low-level hepatic stabilization of Hif-2α had decreased serum cholesterol levels. The decreased amount of acetyl- CoA is likely to contribute to the low serum cholesterol level in the Hif-p4h-2 gt/gt mice (Supplementary Fig. 7), but other mechanisms may also be involved. Mice with adipocyte-specific Hif-p4h-2 deletion also have less WAT, smaller adipocytes, lower number of adipose tissue macrophages and improved glucose tolerance (25), but such 15

16 Diabetes Page 16 of 42 changes were only seen on HFD and no changes were reported in serum cholesterol levels suggesting that Hif-p4h-2 deficiencies in several tissues played an important role in the metabolic changes of the Hif-p4h-2 gt/gt mice. Acute hepatic Hif-p4h-3 deletion has also been reported to improve glucose tolerance and insulin sensitivity, but no data were available on its effects on weight gain or serum cholesterol levels (26). Inhibition of Hif-1α by disruption of its gene in adipocytes (30) or administration of its inhibitor (31) or antisense oligonucleotides (32) attenuates the consequences of a HFD in mice. Currently no explanation is available for the discrepancy between those data and the beneficial effects of Hif-α stabilization by Hif-p4h-2 deficiency, but the additional stabilization of Hif-2α has been suggested to possibly play important roles (25). Administration of FG-4497 to mice in two models of metabolic dysfunction led to changes very similar to those seen in the Hif-p4h-2 gt/gt mice indicating that HIF-P4H-2 inhibition may not only protect against development of obesity and metabolic dysfunction but may also reverse them. FG-4497 inhibits all three HIF-P4Hs, but in view of the changes found in the Hifp4h-2 gt/gt mice it would seem possible to obtain a similar effect with a compound that specifically inhibits HIF-P4H-2. Interestingly, administration of another pan-hif-p4h-inhibitor FG-4592, currently in clinical trials for treatment of anemia of chronic kidney disease, also lowered serum cholesterol levels and increased the HDL/LDL ratio (33, 34), thus supporting the view that HIF- P4H-2 inhibition may indeed be a useful strategy for the treatment of obesity and its consequences. Acknowledgements. We thank T. Aatsinki, R. Juntunen, E. Lehtimäki, S. Rannikko and M. Siurua for excellent technical assistance. 16

17 Page 17 of 42 Diabetes Funding. This study was supported by Academy of Finland Grants , , and (PK), , and Center of Excellence Grant (JM), and also by the S. Jusélius Foundation (PK, JM), the Emil Aaltonen Foundation (PK) and FibroGen, Inc. (JM). Duality of Interest. K.I.K. is a scientific founder and consultant of FibroGen Inc, which develops HIF-P4H inhibitors as potential therapeutics. K.I.K. and J.M. own equity in this company and the company has sponsored research in the laboratory headed by K.I.K. and currently supports research in that headed by J.M. G.W is a senior cell biology director at FibroGen Inc. Author contributions. L.R.-K., S.K., R.S. and P.K. performed most of the research and analyzed data. S.H. provided expertise in serum lipid analyses, R.B.S. and E.L. conducted the MRI analyses, and K.M. and K.-H.H. performed and analyzed the metabolic home cage experiments. G.W. provided the FG-4497 and made useful suggestions. J.M., K.I.K. and P.K. generated the Hif-p4h-2gt/gt mouse line and J.M. took part in useful discussions. K.I.K. and P.K. analyzed the data, designed the research and wrote the paper and P.K. also supervised the project. P.K. is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. References 1. Kaelin WG,Jr, Ratcliffe PJ. Oxygen sensing by metazoans: The central role of the HIF hydroxylase pathway. Mol Cell 2008;30: Semenza GL. Hypoxia-inducible factors in physiology and medicine. Cell 2012;148:

18 Diabetes Page 18 of Myllyharju J, Koivunen P. Hypoxia-inducible factor prolyl 4-hydroxylases: Common and specific roles. Biol Chem 2013;394: Epstein AC, Gleadle JM, McNeill LA, Hewitson KS, O'Rourke J, Mole DR, Mukherji M, Metzen E, Wilson MI, Dhanda A, Tian YM, Masson N, Hamilton DL, Jaakkola P, Barstead R, Hodgkin J, Maxwell PH, Pugh CW, Schofield CJ, Ratcliffe PJ. C. elegans EGL-9 and mammalian homologs define a family of dioxygenases that regulate HIF by prolyl hydroxylation. Cell 2001;107: Bruick RK, McKnight SL. A conserved family of prolyl-4-hydroxylases that modify HIF. Science 2001;294: Ivan M, Haberberger T, Gervasi DC, Michelson KS, Gunzler V, Kondo K, Yang H, Sorokina I, Conaway RC, Conaway JW, Kaelin WG,Jr. Biochemical purification and pharmacological inhibition of a mammalian prolyl hydroxylase acting on hypoxia-inducible factor. Proc Natl Acad Sci U S A 2002;99: Laitala A, Aro E, Walkinshaw G, Mäki JM, Rossi M, Heikkilä M, Savolainen ER, Arend M, Kivirikko KI, Koivunen P, Myllyharju J. Transmembrane prolyl 4-hydroxylase is a fourth prolyl 4-hydroxylase regulating EPO production and erythropoiesis. Blood 2012;120: Takeda K, Ho V, Takeda H, Duan LJ, Nagy A, Fong GH. Placental but not heart defect is associated with elevated HIFα levels in mice lacking prolyl hydroxylase domain protein 2. Mol Cell Biol 2006;22: Takeda K, Cowan A, Fong GH. Essential role for prolyl hydroxylase domain protein 2 in oxygen homeostasis of the adult vascular system. Circulation 2007;116: Minamishima YA, Moslehi J, Bardeesy N, Cullen D, Bronson RT, Kaelin WG,Jr. Somatic inactivation of the PHD2 prolyl hydroxylase causes polycythemia and congestive heart failure. Blood 2008;111: Hyvärinen J, Hassinen IE, Sormunen R, Mäki JM, Kivirikko KI, Koivunen P, Myllyharju J. Hearts of hypoxia-inducible factor prolyl 4-hydroxylase-2 hypomorphic mice show protection against acute ischemia-reperfusion injury. J Biol Chem 2010;285: Kerkelä R, Karsikas S, Szabo Z, Serpi R, Magga J, Gao E, Alitalo K, Anisimov A, Sormunen R, Pietilä I, Vainio L, Koch WJ, Kivirikko KI, Myllyharju J, Koivunen P. Activation of hypoxia response in endothelial cells contributes to ischemic cardioprotection. Mol Cell Biol 2013;33: Yun Z, Maecker HL, Johnson RS, Giaccia AJ. Inhibition of PPAR gamma 2 gene expression by the HIF-1-regulated gene DEC1/Stra13: A mechanism for regulation of adipogenesis by hypoxia. Dev Cell 2002;2:

19 Page 19 of 42 Diabetes 14. Quintero P, Milagro FI, Campion J, Martinez JA. Impact of oxygen availability on body weight management. Med Hypotheses 2010;74: van den Borst B, Schols AM, de Theije C, Boots AW, Kohler SE, Goossens GH, Gosker HR. Characterization of the inflammatory and metabolic profile of adipose tissue in a mouse model of chronic hypoxia. J Appl Physiol 2013;114: Hsieh MM, Linde NS, Wynter A, Metzger M, Wong C, Langsetmo I, Lin A, Smith R, Rodgers GP, Donahue RE, Klaus SJ, Tisdale JF. HIF prolyl hydroxylase inhibition results in endogenous erythropoietin induction, erythrocytosis, and modest fetal hemoglobin expression in rhesus macaques. Blood 2007;110: Bernhardt WM, Gottmann U, Doyon F, Buchholz B, Campean V, Schodel J, Reisenbuechler A, Klaus S, Arend M, Flippin L, Willam C, Wiesener MS, Yard B, Warnecke C, Eckardt KU. Donor treatment with a PHD-inhibitor activating HIFs prevents graft injury and prolongs survival in an allogenic kidney transplant model. Proc Natl Acad Sci U S A 2009;106: Friedewald WT, Levy RI, Fredrickson DS. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem 1972;18: Soh J, Iqbal J, Queiroz J, Fernandez-Hernando C, Hussain MM. MicroRNA-30c reduces hyperlipidemia and atherosclerosis in mice by decreasing lipid synthesis and lipoprotein secretion. Nat Med 2013;19: Harford KA, Reynolds CM, McGillicuddy FC, Roche HM. Fats, inflammation and insulin resistance: Insights to the role of macrophage and T-cell accumulation in adipose tissue. Proc Nutr Soc 2011;70: Fuentes E, Fuentes F, Vilahur G, Badimon L, Palomo I. Mechanisms of chronic state of inflammation as mediators that link obese adipose tissue and metabolic syndrome. Mediators Inflamm 2013;2013: Semenza GL. Regulation of oxygen homeostasis by hypoxia-inducible factor 1. Physiology (Bethesda) 2009;24: Im SS, Kang SY, Kim SY, Kim HI, Kim JW, Kim KS, Ahn YH. Glucose-stimulated upregulation of GLUT2 gene is mediated by sterol response element-binding protein-1c in the hepatocytes. Diabetes 2005;54: Abel ED, Peroni O, Kim JK, Kim YB, Boss O, Hadro E, Minnemann T, Shulman GI, Kahn BB. Adipose-selective targeting of the GLUT4 gene impairs insulin action in muscle and liver. Nature 2001;409:

20 Diabetes Page 20 of Matsuura H, Ichiki T, Inoue E, Nomura M, Miyazaki R, Hashimoto T, Ikeda J, Takayanagi R, Fong GH, Sunagawa K. Prolyl hydroxylase domain protein 2 plays a critical role in dietinduced obesity and glucose intolerance. Circulation 2013;127: Taniguchi CM, Finger EC, Krieg AJ, Wu C, Diep AN, LaGory EL, Wei K, McGinnis LM, Yuan J, Kuo CJ, Giaccia AJ. Cross-talk between hypoxia and insulin signaling through Phd3 regulates hepatic glucose and lipid metabolism and ameliorates diabetes. Nat Med 2013;19: Taniguchi CM, Ueki K, Kahn R. Complementary roles of IRS-1 and IRS-2 in the hepatic regulation of metabolism. J Clin Invest 2005;115: Rankin EB, Rha J, Selak MA, Unger TL, Keith B, Liu Q, Haase VH. Hypoxia-inducible factor 2 regulates hepatic lipid metabolism. Mol Cell Biol 2009;29: Ramakrishnan SK, Taylor M, Qu A, Ahn SH, Suresh MV, Raghavendran K, Gonzalez FJ, Shah YM. Loss of von hippel-lindau (VHL) increases systemic cholesterol level through targeting HIF-2alpha and regulation of bile acid homeostasis. Mol Cell Biol Jiang C, Qu A, Matsubara T, Chanturiya T, Jou W, Gavrilova O, Shah YM, Gonzalez FJ. Disruption of hypoxia-inducible factor 1 in adipocytes improves insulin sensitivity and decreases adiposity in high-fat diet-fed mice. Diabetes 2011;60: Sun K, Halberg N, Khan M, Magalang UJ, Scherer PE. Selective inhibition of hypoxiainducible factor 1α ameliorates adipose tissue dysfunction. Mol Cell Biol 2013;33: Shin MK, Drager LF, Yao Q, Bevans-Fonti S, Yoo DY, Jun JC, Aja S, Bhanot S, Polotsky VY. Metabolic consequences of high-fat diet are attenuated by suppression of HIF-1α. PLoS One 2012;7:e Bakris GL, Yu K-P, Leong R, Shi W, Lee T, Saikali K, Henry E, Neff TB. Effects of a novel anemia treatment, FG an oral hypoxia-inducible prolyl hydroxylase inhibitor (HIF-PHI) on blood pressure and cholesterol in patients with chronic kidney disease. J Clin Hypertension 2013;14: Myllyharju J. Prolyl 4-hydroxylases, master regulators of the hypoxia response. Acta Physiol (Oxf) 2013;208: Figure Legends Figure 1 Hif-p4h-2 gt/gt mice are lighter than their wild-type littermates and have less adipose tissue, smaller adiopocytes and reduced number of macrophage aggregates in white adipose tissue. (A) Western blot analyses of Hif-1α and Hif-2α protein in nuclear fractions of liver and 20

21 Page 21 of 42 Diabetes white adipose tissue (WAT). β-actin was used as a loading control. (B) Weight of 5-week-old female wild-type (wt) and Hif-p4h-2 gt/gt (gt/gt) mice fed normal chow and their weight gain during the subsequent 10 weeks, and weight of 1-year-old female and male mice. (C) Weight of gonadal WAT in 1-year-old male mice. (D) Cross-sectional area of adipocytes in the WAT of 1- year-old male mice. Scale bar 100 µm. (E) Weight of subcutaneous brown adipose tissue (BAT) relative to tibia length in 1-year-old female mice. (F) Magnetic resonance imaging (MRI) analyses of the amount of subcutaneous adipose tissue in 4-month-old female mice. (G) Number of macrophage aggregates in gonadal WAT of 1-year-old male wild-type and Hif-p4h-2 gt/gt mice. Adipocytes surrounded by macrophage aggregates (*). Scale bar 100 µm. All data are mean ± SEM (n = 4-10 per group). *P < 0.05, **P < 0.01 and P = Figure 2 Hif-p4h-2 gt/gt mice have decreased serum cholesterol levels and are protected against hepatic steatosis. (A) Serum total cholesterol, HDL cholesterol and LDL+VLDL cholesterol levels, HDL/LDL+VLDL cholesterol ratios and triglyceride levels of 7-11-month-old male wildtype (wt) and Hif-p4h-2 gt/gt (gt/gt) mice after fasting for 2 h (n = 19 for wt and n = 11 for gt/gt in total cholesterol, HDL and triglyceride values and n = 14 for wt and n = 5 for gt/gt in LDL+VLDL and HDL/LDL+VLDL values). All data are mean ± SEM. (B) Hematoxylin-eosin stained liver sections of 1-year-old male mice (n = 7 for both groups). Scoring of steatosis is shown. Scale bar 200 µm. *P < 0.05, **P = and ***P = Figure 3 Hif-p4h-2 gt/gt mice have improved glucose tolerance, insulin sensitivity and show increased deoxyglucose uptake into skeletal muscle. (A) Glucose tolerance test of 1-year-old and 4-5-month-old female wild-type (wt) and Hif-p4h-2 gt/gt (gt/gt) mice. The 0-min value was determined after fasting for 12 h (n = 9-17 per group). (B) Serum insulin levels and homeostasis model assessment-insulin resistance (HOMA-IR) scores determined from the glucose tolerance test of the 1-year-old mice in (A). (C) Insulin tolerance test of 3-4-month-old female mice. The 0- min value was determined after fasting for 6 h (n = 5-6 per group). The data are shown relative 21

22 Diabetes Page 22 of 42 to glucose values at 0 min. (D) Deoxyglucose uptake test. Eight sibling pairs of wild-type and Hif-p4h-2 gt/gt mice were fasted for 12 h. 14 C-Deoxyglucose was then injected intraperitoneally, the mice were sacrificed 60 min later and their tissues were homogenized and analyzed for radioactivity. D.p.m./mg values for each tissue were compared between the wild-type and Hifp4h-2 gt/gt members of each sibling pair. All data are mean ± SEM.*P < 0.05 and **P < Figure 4 One-year-old wild-type, but not Hif-p4h-2 gt/gt mice, show metabolic dysfunction relative to the corresponding younger mice. (A) Cross-sectional area of adipocytes, (B) number of macrophage aggregates, (C) fasting (12 h) blood glucose values, (D) fasting (12 h) serum insulin values and (E) HOMA-IR scores in 4-5-month-old (young, y) and 1-year-old (old, o) wild-type (wt) and Hif-p4h-2 gt/gt (gt/gt) mice (n = 5-14 per group). All data are mean ± SEM. *P < 0.05, **P < 0.01 and ***P < Figure 5 Hif-p4h-2 gt/gt mice have altered expression of genes of glucose and lipid metabolism and reduced acetyl-coa levels and show reduced lipogenesis. qpcr analyses of the mrna levels of HIF target and lipid metabolism genes in (A) the skeletal muscle and WAT and (B) liver of Hif-p4h-2 gt/gt mice relative to the wild type. Glut1, Glut2 and Glut4, glucose transporters 1, 2 and 4; Hk1, hexokinase-1; Pfkl, phosphofructokinase; Pgk1; phosphoglycerate kinase-1; Gapdh, glyceraldehyde phosphate dehydrogenase; Ldha, lactate dehydrogenase a; Pdk1 and Pdk4, pyruvate dehydrogenase kinases 1 and 4; Pparγ and Pparα, peroxisome proliferator-activated receptors γ and α; Lipe, hormone sensitive lipase; Pnpla2, patatin-like phospholipase domain containing 2; Srebp1c, sterol regulatory element-binding protein 1c; Accα, acetyl-coa carboxylase α; Fas, fatty acid synthase; Irs1 and Irs2, insulin receptor substrates 1 and 2; Ldlr, low density lipoprotein receptor; ApoB, apolipoprotein B. The expression of each gene was studied relative to β-actin (n = 6-9 per group). (C) Level of acetyl-coa in the skeletal muscle, 22

23 Page 23 of 42 Diabetes WAT and liver, and (D) incorporation of radioactivity from [ 14 C]acetate into extractable lipids as an indication of lipogenesis in the WAT and liver of 4-5-month-old male wild type (wt) and Hifp4h-2 gt/gt (gt/gt) mice, expressed per mg tissue wet weight (n = 4-7 per group in (C) and n = 9-10 per group in (D)). All data are mean ± SEM.*P < 0.05, **P < 0.01 and ***P < Figure 6 Hif-p4h-2 gt/gt mice are protected against high-fat diet induced metabolic changes and steatosis. (A) Weight of 6-month-old female wild-type and Hif-p4h-2 gt/gt mice before and after administration of HFD for 6 weeks (n = 7-10 per group). (B) Cross-sectional area of WAT adipocytes. (C) Number of macrophage aggregates (aggregates/field) in gonadal WAT. (D) Glucose tolerance test after the 6-week HFD administration. The 0-min value was determined after fasting for 12 h. (E) Hematoxylin-eosin stained liver sections of these HFD-fed mice. Scoring of steatosis is shown. Scale bar 200 µm. All data are mean ± SEM.*P < 0.05, **P < Figure 7 Pharmacological Hif-p4h inhibition reverses metabolic dysfunction in both aged mice and mice fed HFD. (A-E) 1-year-old male wild-type mice fed normal chow were given vehicle or 60 mg/kg of FG-4497 on days 1, 3 and 5 of each week for 6 weeks (n = 6-7 per group). (A) Weight gain of the mice at 6 weeks relative to their weights at 1 week (adjustment period). (B) Cross-sectional area of WAT adipocytes, scale bar 100 µm. (C) Number of WAT macrophage aggregates (*) (aggregates/field), scale bar 100 µm. (D) Serum total cholesterol, HDL cholesterol and LDL+VLDL cholesterol levels and HDL/LDL+VLDL cholesterol ratios measured after fasting for 2 h. (E) Blood glucose and serum insulin levels and HOMA-IR scores determined from the samples in (D). (F-I) Two-month-old male wild-type mice (n = 8-10 per group) were fed normal chow or HFD (42 % kcal fat) for 6 weeks, after which the mice fed normal chow were given vehicle and those fed HFD were given either HFD and vehicle or HFD and FG-4497 for 4 weeks as in (A-E). (F) Weight of the mice fed normal chow or HFD before and after the administration of vehicle or FG (G) Weight of gonadal WAT of HFD-fed 23

24 Diabetes Page 24 of 42 mice after the 4-week vehicle or FG-4497 treatment. (H) Glucose tolerance test of the HFD-fed mice after the 4-week vehicle or FG-4497 administration. The 0-min value was determined after fasting for 12 h. (I) Serum insulin levels and HOMA-IR scores determined from the glucose tolerance test in (H). All data are mean ± SEM.*P < 0.05, **P < 0.01 and ***P <

25 Page 25 of 42 Diabetes Figure 1 99x60mm (300 x 300 DPI)

26 Diabetes Page 26 of 42 Figure 2 57x39mm (300 x 300 DPI)

27 Page 27 of 42 Diabetes Figure 3 123x107mm (600 x 600 DPI)

28 Diabetes Page 28 of 42 Figure 4 47x15mm (600 x 600 DPI)

29 Page 29 of 42 Diabetes Figure 5 108x77mm (600 x 600 DPI)

30 Diabetes Page 30 of 42 Figure 6 55x17mm (300 x 300 DPI)

31 Page 31 of 42 Diabetes Figure 7 154x166mm (300 x 300 DPI)

32 Diabetes Page 32 of 42 SUPPLEMENTARY DATA Rahtu-Korpela et al. Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA Hif-p4h-1 GGCAACTACGTCATCAATG ACCTTAACATCCCAGTTCTGA Ucp1 GGCCAGGCTTCCAGTACCATTAG GTTTCCGAGAGAGGCAGGTGTTTC Adiponectin GTCAGTGGATCTGACGACACCAA ATGCCTGCCATCCAACCTG Leptin CAAGCAGTGCCTATCCAGA AAGCCCAGGAATGAAGTCCA Ccl2 CCTGCTGTTCACAGTTGCC ATTGGGATCATCTTGCTGGT Glut1 Quantitect primer assays (Qiagen) Glut2 TTCCAGTTCGGCTATGACATCG CTGGTGTGACTGTAAGTGGGG Glut4 Quantitect primer assays (Qiagen) Hk1 Quantitect primer assays (Qiagen) Pfkl Quantitect primer assays (Qiagen) Pgk1 GGAGCGGGTCGTGATGA GCCTTGATCCTTTGGTTGTTTG Gapdh TGTGTCCGTCGTGGATCTGA TTGCTGTTGAAGTCGCAGGAG Ldha GGATGAGCTTGCCCTTGTTGA GACCAGCTTGGAGTTCGCAGTTA Pdk1 Quantitect primer assays (Qiagen) Pdk4 Quantitect primer assays (Qiagen) Pparɣ GCCCACCAACTTCGGAATC TGCGAGTGGTCTTCCATCAC Pparα CCTGAACATCGAGTGTCGAATAT GTTCTTCTTCTGAATCTTGCAGCT Srebp1c GAGCCATGGATTGCACATTT CTCAGGAGAGTTGGCACCTG Accα GAAGTCAGAGCCACGGCACA GGCAATCTCAGTTCAAGCCAGTC Lipe CAGAAGGCACTAGGCGTGATG GGGCTTGCGTCCACTTAGTTC Pnpla2 CAACGCCACTCACATCTACGG GGACACCTCAATAATGTTGGCAC Fas TCCTGGAACGAGAACACGATCT GAGACGTGTCACTCCTGGACTTG Irs1 TCCCAAACAGAAGGAGGATG CATTCCGAGGAGAGCTTTTG Irs2 GTAGTTCAGGTCGCCTCTGC TTGGGACCACCACTCCTAAG Ldlr TCCCTGGGAACAACTTCACC CACTCTTGTCGAAGCAGTCAG ApoB TTGGCAAACTGCATAGCATCC TCAAATTGGGACTCTCCTTTAGC

33 Page 33 of 42 Diabetes Supplementary Figure 1. Hif-p4h-2 mrna and protein levels, Hif-p4h-1 mrna levels, tibia lengths, liver weights and uncoupling protein 1 (Ucp1) mrna levels in the Hif-p4h-2 gt/gt and wildtype mice. (A) qpcr analysis of wild-type Hif-p4h-2 and Hif-p4h-1 mrna levels in Hif-p4h-2 gt/gt tissues relative to those in the wild type. SKM = skeletal muscle, WAT = white adipose tissue and BAT = brown adipose tissue. (B) Tibia lengths of 1-year-old female and male wild-type (wt) and Hif-p4h-2 gt/gt (gt/gt) mice and their liver weights relative to tibia length (n = 6-10 per group). (C) Western blot analysis of Hif-p4h-2 protein levels in cytosolic fractions of WAT. α-tubulin was used as a loading control. A buffer of 8M Urea, 300 mm NaCl, 40 mm Tris-HCl ph 7.6 and 0.5% NP-40 was used to prepare cytosolic fractions. The blots were probed with primary antibodies for Hif-p4h- 2 (NB , Novus) and α-tubulin (T-6199, Sigma-Aldrich). (D) qpcr analysis of the Ucp1 mrna levels in BAT relative to β-actin. All data are mean ± SEM. *P < 0.015, **P < 0.01 and ***P < Supplementary Figure 2. Hif-p4h-2 gt/gt mice have no alterations in the amount of food intake and physical activity. Metabolic home cage analyses of food intake (normal chow) (g food/mouse/98 h, g food/g body weight/98 h), physical activity (counts/24 h), O 2 consumption and CO 2 production (l/h/kg) of 4-month-old female mice (n = 4 per group). Respiratory exchange ratio (RER) is also shown. Before the measurements the mice were housed singly for 9 days in training cages similar to those used in the actual measurements, in order to minimize the stress effect. All the cages were equipped with wooden chips as bedding. An automated analyzing system (LabMaster, TSE Systems GmbH, Bad Homburg, Germany) was used for data measurement. The data were collected for 4 days (98 h) (measurement started at 9:00 a.m.) at room temperature (21 ± 1 C, air humidity 40 60%). The mice had free access to tap water and food during all the experiments. The experimental room had a h light/dark rhythm (lights on 7:00 a.m. 7:00 p.m.). All data are mean ± SEM. * P < 0.05.