Time after injection (hours) ns ns

Size: px
Start display at page:

Download "Time after injection (hours) ns ns"

Transcription

1 Platelet life span (% iotinylated platelets) Time after injection (hours) IgG GPIα GPIβ GPII GPVI Receptor expression (GeoMean, fluorescence inteity) Supplementary figure 1. Platelet life span and surface adhesion receptors expression in unaltered in ζ-deficient mice ζ-wt and ζ-deficient (14-3-3ζ-null) were examined for (a) Platelet life span (n = 4) and () receptor expression [14-3-3ζ-wt n=11; ζ-null n=12], as descried under Materials and Methods. Results were analyzed using two-way ANOVA with Bonferroni s post-hoc test.

2 ai ADP 1 µm ζ-null Maximal aggregation (%) ii No. adherent platelets/field ζ-wt Supplementary figure 2. GPIα-VWF adhesion and platelet aggregation are unaffected in ζ-deficient mouse platelets. (a) Adhesion of ζ-wt or ζ-deficient (14-3-3ζ-null) platelets (2 x 17 ml-1) to human VWF (5 µg ml-1) in the presence of otrocetin (1 µg ml-1) was examined, as descried under Methods. Platelet adhesion was imaged y DIC microscopy (Leica DMIRB, water immersion ojective: x 63, NA: 1.2) and images captured using DVT tools (Pinnacle Systems, USA). (i) Images are taken from one experiment, representative of 5 independent experiments, with the histogram (ii) depicting the numer of adherent platelets per field (mean ± SEM, n=5). () Aggregation of washed platelets in respoe to CRP or ADP was compared etween ζ-wt or ζ-null mice. This histogram depicts the mean +/- SEM of 3 independent experiments. (a,) Results were analyzed using a 2-way ANOVA (Bonferroni s post-hoc testing).

3 c P-sel +ve platelets (% gated) CRP/Thr Iono PAC-1 +ve platelets (% Gated) CRP/Thr Iono # Procoagulant platelets (% total cells/field) * * 9 27 Time (secs) Vehicle RB-11 Supplementary figure 3. The dimer destailiser reduces platelet procoagulant function under flow conditio. Washed platelets were isolated from anticoagulated whole lood from healthy volunteer donors and treated with a dimer destailiser (RB-11, 1 μm) or vehicle (sodium mesylate salt). (a) Washed platelets were perfused into Type I collagen (25 µg ml -1 ) coated microslides at 3 s -1, and allowed to settle for 5 minutes in the asence of flow. Development of procoagulant platelet morphology was assessed under flow conditio (3 s -1 ) over time using DIC microscopy [Leica DMIRB, water immersion ojective: x63, NA 1.2] and images recorded for off-line analysis using Image J. The numer of procoagulant platelets was expressed as a % of the total numer of platelets per field. Results are expressed as the mean ± SEM (n=3), and analysed using a 2-way ANOVA (Bonferroni s post-hoc testing) where *p<.5. () P-selectin and (c) integrin α II β 3 activation in respoe to the indicated concentratio of agonist were quantified through measurement of FITC-conjugated P-selectin (P-sel +ve ) or PAC-1 antiody inding, respectively, as descried under Methods.

4 ANV +ve platelets (% gated) ANV +ve platelets (% gated) ABT-737 Incuation time (min) Ionophore A23187 (µm) Supplementary figure 4. PS exposure in respoe to apoptosis or calcium ionophore are normal in ζ-deficient platelets. Diluted whole lood samples from ζ-wt (lack ars) or ζ-deficient (14-3-3ζ-null, lue ars) mice were treated with (a) ABT-737 [1 µm, indicated times, n=3-6] or () calcium ionophore A23187 [3 min, n=1], in the presence of Alexa-488-laelled Annexin V (ANV). Each figure represents the percentage (%) of platelets positive for Annexin V (ANV+ve platelets). Results are expressed as mean ± SEM from the indicated numer of independent experiments (a: n=3; : n=5), and analysed using a 2-way ANOVA (Bonferroni s post-hoc testing), where p>.5. where

5 Calcium flux (fold increase aove asal) 1 a) CRP/Thr Calcium flux (fold increase aove asal) ) CRP/Thr + EGTA Calcium flux (nm) c) Thromin (.5 U/ml) Time (sec) 3 4 Supplementary figure 5. Calcium flux in respoe to agonist is unchanged in ζ-deficient mice. Washed platelets isolated from ζ-wt (lack) or ζ-deficient (14-3-3ζ-null, red) mice were loaded with calcium dyes and calcium flux measured over time using a ratiometric calcium assay, in respoe to CRP (1 µg ml-1)/thromin (1. U ml-1), in the asence (a) or presence () of EGTA (2 mm) or thromin alone (.5 U ml-1) (c), as descried under Methods. Results depict the fold increase in calcium over asal (resting) level, and represent the mean ± SEM from 3 independent experiments, performed in duplicate. Statistical analysis using a 2-way ANOVA demotrated no statistical significance over the time course etween genotypes (p>.5)

6 Intraplatelet metaolic ATP (% resting) 1 5 ** Vehicle RB-11 **** *** Time (minutes) OCR (%asal) Vehicle RB-11 **** *** **** c Reserve capacity (OCR from % of asal) * Time (minutes) Vehicle RB-11 Supplementary figure 6. RB-11 reduces metaolic ATP depletion and mitochondrial oxygen coumption rate. Washed platelets were isolated from anticoagulated whole lood from healthy volunteer donors and treated with a dimer destailizer (RB-11, 1 μm) or vehicle (sodium mesylate salt). Metaolic ATP (a) and oxygen coumption rate (OCR) () following stimulation with CRP/Thromin were quantified, as descried under Methods. OCR has een depicted over the entire 6 minute time course (i), or as a specific change in reserve respiratory capacity, with % OCR increase over asal (ii). Results are expressed as the mean ± SEM (n=3), and analysed using a 2-way ANOVA (Bonferroni s post-hoc testing) where p>.5. These results indicate that treatment of human platelets with the dimer destailizer is coistent with the phenotype of ζ-deficient mouse platelets.

7 ECAR (% asal) Glycolysis Glycolytic capacity Glycolytic reserve ECAR (mph/min) agonist + agonist Non- glycolytic acidification c PK Kinetics 1. min min min OD 57 nm OD 57 nm OD 57 nm d 6-PFK Kinetics 1. min min min OD 57 nm OD 57 nm OD 57 nm Supplementary figure 7. Normal glycolytic capacity in ζ-deficient platelets. (a, ) Washed platelets were isolated from ζ-wt (closed symols) or ζ-deficient (14-3-3ζ-null) mice (open symols). (a, ) Glycolytic capacity was measured in DMEM modified media using the Seahorse XFp analyser, according to manufacturer s itructio. (a) Representative trace identifying the typical pattern of ECAR, depicting asal level, glycolysis (lue), glycolytic capacity (green) and reserve capacity, following the injection of drugs including: 1) vehicle or agonist; 2) Glucose; 3) Oligomycin and 4) 2-DG. () Platelets were assayed for H + production in un-stimulated or CRP/thromin-stimulated (.25 µg ml -1 ;.5 U ml -1, +agonist)) conditio. (c, d) Pyruvate kinase (PK) (c) and 6-Phosphopyruvate kinase (6-PFK) (d) enzyme activity was measured in platelets treated with CRP/thromin (.25 μg ml -1,.5 U ml -1 ) for -3 min, as descried in Methods. Results depict kinetics of enzyme activity in 5 min increments, and represent the mean ± SEM (n=3). 2-way ANOVA statistical analysis (With Bonferroni s Post-hoc testing) was performed, with no statistical significance identified etween ζ-wt and ζ-deficient samples.

8 14-3-3z lysates wt null wt null wt null wt null wt null 1 kda 5 kda 37 kda 2 kda immunolot β/α γ τ ζ Pan c ζ-wt ζ-null IP: GPIα Lysate 1 kda 55 kda 35 kda Pan kda 7 kda 55 kda 35 kda Phospho AMPK β-actin 15 kda 25 kda MW wt null wt null Supplementary Figure 8 - Original immunolot data. Original uncropped immunolot data used in Fig. 3g (a), Fig. 3i () and Fig. 6 (c).

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a OD c. 1. 1... Time [min] 1 p

More information

Supplemental information

Supplemental information Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman

More information

ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and

ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and Supplementary Methods and isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the, ILC2 and subsets. For this purpose we performed intracellular flow cytometry

More information

Application Note. Introduction

Application Note. Introduction Simultaneously Measuring Oxidation of Exogenous and Endogenous Fatty Acids Using the XF Palmitate-BSA FAO Substrate with the Agilent Seahorse XF Cell Mito Stress Test Application Note Introduction The

More information

A Slfn2 mutation causes lymphoid and myeloid immunodeficiency due to loss of immune cell quiescence

A Slfn2 mutation causes lymphoid and myeloid immunodeficiency due to loss of immune cell quiescence Supplementary Information A Slfn mutation causes lymphoid and myeloid immunodeficiency due to loss of immune cell quiescence Michael Berger, Philippe Kres, Karine Crozat, Xiaohong Li, Ben A. Croker, Owen

More information

Quantifying Cellular ATP Production Rate Using Agilent Seahorse XF Technology

Quantifying Cellular ATP Production Rate Using Agilent Seahorse XF Technology White Paper Quantifying Cellular ATP Production Rate Using Agilent Seahorse XF Technology Authors Natalia Romero George Rogers Andy Neilson Brian P. Dranka Agilent Technologies, Inc., Lexington, MA, USA

More information

Supplemental information

Supplemental information Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table. Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1. (A) Representative confocal analysis of cardiac mesenchymal cells from nondiabetic (ND-CMSC) and diabetic (D-CMSC) immunostained with anti-h3k9ac and anti-h3k27me3 antibodies. Analysis

More information

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180

More information

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80 a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2

More information

Target Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3

Target Primer Sequence Source. Arginase-1 Forward 5 -GCTCAGGTGAATCGGCCTTTT TGGCTTGCGAGACGTAGAC-3. CD36 Forward 5 - TTTCCTCTGACATTTGCAGGTCTA-3 Yu et al: Rosuvastatin reduces aortic sinus and coronary artery atherosclerosis in SR-B1/apoE dko mice. Supplementary Tale i: Primers used for RT-PCR. References are provided under Source, except for primers

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Advances in pancreatic islet monolayer culture on glass surfaces enable superresolution microscopy and insights into beta cell ciliogenesis and proliferation Edward A. Phelps,

More information

Nature Immunology: doi: /ni.3631

Nature Immunology: doi: /ni.3631 Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + + FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP

More information

Supplemental Figures:

Supplemental Figures: Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)

More information

XF Data Normalization by the Agilent Seahorse XF Imaging and Normalization System

XF Data Normalization by the Agilent Seahorse XF Imaging and Normalization System Application Note Normalization XF Data Normalization by the Agilent Seahorse XF Imaging and Normalization System Authors Yoonseok Kam Kellie Chadwick Ned Jastromb Brian P. Dranka Agilent Technologies,

More information

Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1

Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1 % of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with

More information

Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID

Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream

More information

% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1.

% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1. A B C T cell count (1 6 ) 3. 2. 1.. * % of Max CFSE ormoxia ypoxia o Stim. Proliferation Index 2.5 2. 1.5 1. * Division Index 2. 1.5 1..5. D E %Ki67+ cells 1 8 6 4 2 % of Cells 8 ormoxia 6 ypoxia 4 2 *

More information

Supplementary Figures

Supplementary Figures Supplementary Figures a b c d PDI activity in % ERp72 activity in % 4 3 2 1 1 1 ERp activity in % e ΔRFU min -1 1 1 ERp7 activity in % 1 1 Supplementary Figure 1. Selectivity of the bepristat-mediated

More information

Supplementary Material

Supplementary Material Supplementary Material HLA-DM Captures Partially Empty HLA-DR Molecules for Catalyzed Peptide Removal Anne-Kathrin Anders, Melissa J. Call, Monika-Sarah E. D. Schulze, Kevin D. Fowler, David A. Schuert,

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody. ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±

More information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

More information

Ctrl CCT7 CCT2 GAPDH * * ** ** * Ctrl Size of LC3 dots (a.u.) mrfp GFP mrfp-gfp-lc3 CCT5 KD CCT7 KD

Ctrl CCT7 CCT2 GAPDH * * ** ** * Ctrl Size of LC3 dots (a.u.) mrfp GFP mrfp-gfp-lc3 CCT5 KD CCT7 KD CCT7 Size of dots (a.u.) CCT7 CCT7 /GAPH deitometry (a.u.) /GAPH deitometry (a.u.) a CCT7 Primary cortical neuro 55 CCT5 55 CCT7 55 CCT7 55 55 55 c 3 25 2 DMSO 2 8 Bafilomycin A 5 6 4 5 2 2 3 2 3 d mrfpgfp

More information

Identifying Metabolic Phenotype Switches in Cancer Cells Using the Agilent Seahorse XF Analyzer in an Hypoxic Environment

Identifying Metabolic Phenotype Switches in Cancer Cells Using the Agilent Seahorse XF Analyzer in an Hypoxic Environment Identifying Metabolic Phenotype Switches in Cancer Cells Using the Agilent Seahorse XF Analyzer in an Hypoxic Environment Application Note Introduction Decreased oxygen levels, or hypoxia, and hypoxic-mediated

More information

Supporting Information

Supporting Information Supporting Information van der Windt et al. 10.1073/pnas.1221740110 SI Materials and Methods Mice and Reagents. C57BL/6 and major histocompatibility complex class I-restricted OVA-specific T-cell receptor

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

SUPPLEMENT Supplementary Figure 1: (A) (B)

SUPPLEMENT Supplementary Figure 1: (A) (B) SUPPLEMENT Supplementary Figure 1: CD4 + naïve effector T cells (CD4 effector) were labeled with CFSE, stimulated with α-cd2/cd3/cd28 coated beads (at 2 beads/cell) and cultured alone or cocultured with

More information

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p. a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure

More information

effect on the upregulation of these cell surface markers. The mean peak fluorescence intensity

effect on the upregulation of these cell surface markers. The mean peak fluorescence intensity SUPPLEMENTARY FIGURE 1 Supplementary Figure 1 ASIC1 disruption or blockade does not effect in vitro and in vivo antigen-presenting cell activation. (a) Flow cytometric analysis of cell surface molecules

More information

Cell Metabolism Assays. for. Immunology. Research

Cell Metabolism Assays. for. Immunology. Research the immunity-metabolism link Cell Metabolism Assays for Immunology Research GOLD STANDARD ASSAYS FOR MEASURING METABOLIC RePROGRAMMING Metabolic Signatures Cell activation, amplification, and effector

More information

SUPPLEMENTAL MATERIAL. Supplementary Methods

SUPPLEMENTAL MATERIAL. Supplementary Methods SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was

More information

Phenotype Determines Nanoparticle Uptake by Human

Phenotype Determines Nanoparticle Uptake by Human Phenotype Determines Nanoparticle Uptake by Human Macrophages from Liver and Blood Sonya A. MacParland a,b,, Kim M. Tsoi c,d,, Ben Ouyang c, Xue-Zhong Ma a, Justin Manuel a, Ali Fawaz b, Mario A. Ostrowski

More information

Performing Bioenergetic Analysis: Seahorse XFe96 Analyzer

Performing Bioenergetic Analysis: Seahorse XFe96 Analyzer icell Cardiomyocytes 2 Application Protocol Performing Bioenergetic Analysis: Seahorse XFe96 Analyzer Introduction The myocardium is the most metabolically active tissue in the body and is highly sensitive

More information

Agilent Technologies: Seahorse XF Introduction

Agilent Technologies: Seahorse XF Introduction Agilent Technologies: Seahorse XF Introduction Tools for investigating cell metabolism diagnostic procedures. 1 The Engines Cells Generate Energy via Two Metabolic Pathways Glycolysis [ H + ] Respiration

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

glucose glucose 6-phospho fructose 6-phosphate fructose 1,6-bisphosphate glyceraldehyde 3-phosphate 1,3-bisphosphoglycerate 3-phosphoglycerate

glucose glucose 6-phospho fructose 6-phosphate fructose 1,6-bisphosphate glyceraldehyde 3-phosphate 1,3-bisphosphoglycerate 3-phosphoglycerate Cells glucose glucose glucose 6-phospho glycogen pentose phosphate T 1-phosphate 6-phosphate gluconate CC T CC+PD-1 pathway Isobar: fructose 1,6-diphosphate; glucose 1,6-diphosphate DHAP lactate fructose

More information

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1

More information

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

More information

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were

More information

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with

More information

More than 1.9 billion adults are overweight or obese, representing

More than 1.9 billion adults are overweight or obese, representing Articles https://doi.org/1.138/s419-18-21-7 Metabolic reprogramming of natural killer cells in obesity limits antitumor respoes Xavier Michelet 1,2,8, Lydia Dyck 3,8, Andrew Hogan 4, Roisin M. Loftus 3,

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.

More information

Supplementary Figures

Supplementary Figures Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1

More information

McWilliams et al., http :// /cgi /content /full /jcb /DC1

McWilliams et al., http ://  /cgi /content /full /jcb /DC1 Supplemental material JCB McWilliams et al., http ://www.jcb.org /cgi /content /full /jcb.201603039 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. In vitro characterization of mito-qc. (A and B) Analysis

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

NC bp. b 1481 bp

NC bp. b 1481 bp Kcna3 NC 11 178 p 1481 p 346 p c *** *** d relative expression..4.3.2.1 CD4 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna Kcna6 Kcna7 Kcnn4 relative expression..4.3.2.1 CD8 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna

More information

Novel Regulation of Glycoprotein VI Signaling in platelets

Novel Regulation of Glycoprotein VI Signaling in platelets Novel Regulation of Glycoprotein VI Signaling in platelets Satya P. Kunapuli, Ph.D. Department of Physiology, Sol Sherry Thrombosis Research Center Temple University School of Medicine, Philadelphia, PA

More information

PFK Activity Assay Kit (Colorimetric)

PFK Activity Assay Kit (Colorimetric) PFK Activity Assay Kit (Colorimetric) Catalog Number KA3761 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition

More information

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)

More information

SUPPLEMENT. Materials and methods

SUPPLEMENT. Materials and methods SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Table 1. Primer sequences for transcript analysis Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC

More information

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC

More information

Boucher et al NCOMMS B

Boucher et al NCOMMS B 1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;

More information

Supplementary Material

Supplementary Material Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) .

Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) . Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) The inhibitory effects of new antibodies (Mab17 and Mab18). They were investigated in in vitro fertilization

More information

Pyruvate Alanine 0.15 *** ** ***

Pyruvate Alanine 0.15 *** ** *** SUPPLEMENTARY FIGURES Glucose ΔµM from fresh media / mg protein -1-2 -3 - -.1 -.3 -.5 Lactate Alanine Formate ΔµM from fresh media / mg protein 5 3 2 1.15.1.5.6..2.. NS-3 WT-NS G93A-NS Supplementary Figure

More information

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular

More information

tom tom 24hpf tom tom 48hpf tom 60hpf tom tom 72hpf tom

tom tom 24hpf tom tom 48hpf tom 60hpf tom tom 72hpf tom a 24hpf c 48hpf d e 60hpf f g 72hpf h i j k ISV ISV Figure 1. Vascular integrity defects and endothelial regression in mutant emryos. (a,c,e,g,i) Bright-field and (,d,f,h,j) corresponding fluorescent micrographs

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Lane: 1. Spectra BR protein ladder 2. PFD 3. TERM 4. 3-way connector 5. 2-way connector

Lane: 1. Spectra BR protein ladder 2. PFD 3. TERM 4. 3-way connector 5. 2-way connector kda 1 2 3 4 5 26 14 1 7 Lane: 1. Spectra BR protein ladder 2. PFD 3. TERM 4. 3-way connector 5. 2-way connector 5 4 35 25 15 1 Supplementary Figure 1. SDS-PAGE of acterially expressed and purified proteins.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α

More information

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12. Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

More information

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

Supplemental Figure S1. RANK expression on human lung cancer cells.

Supplemental Figure S1. RANK expression on human lung cancer cells. Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Figure 1 A 2.0. Akt308 Akt Ctl 1h 3h 6h 9h 12h. β-cat. GSK3β. pakt308. pgsk3β/edu E-cad/pAkt308. Akt1. Actin.

Figure 1 A 2.0. Akt308 Akt Ctl 1h 3h 6h 9h 12h. β-cat. GSK3β. pakt308. pgsk3β/edu E-cad/pAkt308. Akt1. Actin. Figure 1 pβcat552 β-cat pgsk3β GSK3β 110 110 pgsk3β/du -cad/ TL 20 µm 20 µm pkt473 pankt pkt473 pankt (days) 0 1 2 3 4 (h) 0 1 3 6 9 12 pβ-cat552/nuclei ensitometricanalysis (Pixel intensity) F ensitometricanalysis

More information

Supplementary Information. Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module

Supplementary Information. Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module Supplementary Information Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module O Neil Wiggan, Bryce Schroder, Diego Krapf, James R. Bamurg and Jennifer G. DeLuca

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Appendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13

Appendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13 Appendix Table of Contents. Appendix Figure legends S-S3 and Appendix Table S and S. Appendix Figures S-S3 . Appendix Figure legends S-S3 and Appendix Table S and S Appendix Figure S. Western blot analysis

More information

Procaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk

Procaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk A HeLa actin - + + - - + Cytochrome C (1 M) Z-VAD-fmk PMN - + + - - + actin Cytochrome C (1 M) Z-VAD-fmk Figure S1. (A) Pan-caspase inhibitor z-vad-fmk inhibits cytochrome c- mediated procaspase-3 cleavage.

More information

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6. Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,

More information

Supplementary Figure S1. TRAIL-induced necroptosis at acidic phe is dependent on

Supplementary Figure S1. TRAIL-induced necroptosis at acidic phe is dependent on Online supplementary information Supplementary Figure S1. TRAIL-induced necroptos at acidic phe is dependent on RIPK1 and RIPK3. (a) HT29 cells were tranently transfected with RIPK1, RIPK3, RIPK1/ RIPK3

More information

Hidenobu Kanda, Rebecca Newton, Russell Klein, Yuka Morita, Michael D. Gunn & Steven D. Rosen

Hidenobu Kanda, Rebecca Newton, Russell Klein, Yuka Morita, Michael D. Gunn & Steven D. Rosen Autotaxin, a lysophosphatidic acid-producing ectoenzyme, promotes lymphocyte entry into secondary lymphoid organs Hidenou Kanda, Reecca Newton, Russell Klein, Yuka Morita, Michael D. Gunn & Steven D. Rosen

More information

Supplementary Data Table of Contents:

Supplementary Data Table of Contents: Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary

More information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!

More information

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).

More information