Red clover (Trifolium pratense L.) draft genome provides a. platform for trait improvement
|
|
|
- Jennifer Marshall
- 5 years ago
- Views:
Transcription
1 Red clover (Trifolium pratense L.) draft genome provides a platform for trait improvement Jose J. De Vega 1,2*, Sarah Ayling 1, Matthew Hegarty 2, Dave Kudrna 3, Jose L. Goicoechea 3, Åshild Ergon 4, Odd A. Rognli 4, Charlotte Jones 2, Martin Swain 2, Rene Geurts 5, Chunting Lang 5, Klaus F. X. Mayer 6, Stephan Rössner 6, Steven Yates 2,7, Kathleen J. Webb 2, Iain S. Donnison 2, Giles E. D. Oldroyd 8, Rod A. Wing 3, Mario Caccamo 1, Wayne Powell 2,9, Michael T. Abberton 2,10, Leif Skøt 2* 1 The Genome Analysis Centre, Norwich Research Park, Norwich, NR4 7UH, UK 2 Institute of Biological, Environmental and Rural Sciences, Aberystwyth University, Gogerddan, Aberystwyth, Ceredigion SY23 3EB, UK 3 Arizona Genomics Institute, School of Plant Sciences, University of Arizona, Tucson AZ 85721, USA 4 Norwegian University of Life Sciences, Department of Plant Sciences, N-1432, Ås, Norway 5 Laboratory of Molecular Biology, Department of Plant Science, Wageningen University, Droevendaalsesteeg 1, 6708PB Wageningen, The Netherlands 6 MIPS/Institute for Bioinformatics and Systems Biology, Helmholtz Center Munich, Ingolstädter Landstrasse 1, Neuherberg, Germany 7 Forage Crop Genetics, Institute of Agricultural Sciences, ETH Zurich, CH-8092, Zurich, Switzerland 8 Department of Disease and Stress Biology, John Innes Centre, Norwich NR4 7UH, UK 9 CGIAR Consortium Office 1000, Avenue Agropolis, F-34394, Montpellier, Cedex 5, France 10 International Institute of Tropical Agriculture (IITA), PMB 5320, Oyo Road, Ibadan, Nigeria * Jose.DeVega@tgac.ac.uk; lfs@aber.ac.uk
2 Supplementary Material Figures 1-23 Tables 1-6 Supplementary References
3 Supplementary Figures Figure 1. Cumulative length (y-axis) plot of the red clover scaffolds sorted by length (x-axis) in the final assembly produced with Platanus (Black line) and an alternative assembly assembled with ABySS and scaffolds with SOAP2 (Red line). (Top) All the scaffolds, and (Bottom) the longest scaffolds.
4 Figure 2. Comparison of the Kmer spectra of four assembly strategies. The K-mer spectra of the paired-end and single-end reads versus the different output of the assemblers. The area under the curve of the Kmer spectra has been coloured according to the number of times that such K-mers appear in the assembly: none in back, once in red, twice in orange, etc. Platanus (Final reference)
5 ABySS
6 SOAP2
7 SOAP2 + GAPCLOSER
8 Figure 3. K-mer spectra of the red clover assembly described previously 1 (see also Results section).
9 Figure 4. Genetic map of red clover Milvus x Britta F1 population. Genetic distances on the left of each linkage group (LG) are in cm. LG1 LG2 LG3 LG4 LG5 LG6 LG RCS1715 RCS6823 TA4111 b08e16 TA3683 TA19 TA3816 Tp_GeM20 a06l05 RCS7242 BB TA1734 RCS3555 RCS1621 TA77 RCS1777 A06E06.1 prs MtBA34D12 Ctg419 TA208 TA1387 TA1656 BB BB a04g20 BB Tp_GeM57 TA11 TA2758 BB Tp_GeM46 prs510 RCS4577 RCS1864 RCS ats032 A06E06.2 TA2729 ats227.1 C0002O12.f ats227.2 TA2900 BB RCS1587 RCS6582 RCS6448 AB RCS1735 C0044C16.r C0034P02.f TA2031 TA595 BB RCS6010 Tp_GeM07 TA3953 RCS1007 BB c0032d02 BB TA1580 C0034I10.f TA3981 BB TA RCS RCS3346 BB RCS5390 RCS7089 TA507 A02H03 RCS1647 TA1379 RCS1303 BB TA2012 TA749 RCS3477 TA3111 TA4264 TA3695 TA1636 TA1106 TA955 BB BB C0007F10.r TA944 TA519 RCS a08f12 TA496 TA989 C0043G10.f A01C10 BB BB BB RCS0131 RCS1148 RCS5643 RCS1594 RCS TA3179 TA712 BB C0006K14.f TA33 RCS2032 b0002l10 TA3505 TA1672 BB TA3611 RCS1150 RCS1080 RCS0069 RCS5457 RCS6986 RCS RCS RCS2866 RCS0685 TA460 a0005b17 BB RCS5574 TA2998 TA prs RCS4310
10 Figure 5. Landscapes of the red clover chromosomes. The landscapes represent the proportion (0-1) of content along the chromosome in 10Kb intervals of each of the elements in different categories. Top panel: Density of various types of repetitive elements. Circular symbols represent genetic markers. Green line is gene density per Mb. So, a density of 0.5 means that the gene content (exons and introns) occupied 500 Kb of each 1 Mb in each window. Bottom panel: Expected minus Observed Heterozygosity. Chromosome 1 Chromosome 2
11 Chromosome 3 Chromosome 4
12 Chromosome 5 Chromosome 6
13 Chromosome 7
14 Figure 6. Comparison of gene features. Length and frequency of the features (genes, transcripts, CDS and exons/introns) in the red clover (Tp), common bean (Pv), M. truncatula (Mt), L. japonicus (Lj), soybean (Gm) and A. thaliana (At) genomes.
15 Figure 7. GO terms over-represented in red clover gene clusters that are expanded in comparison with M. truncatula. (A) Scatter-plot that represents the number of genes in each cluster in M. truncatula (X-axis) and red clover (Y-axis). A cluster is expanded when the number of members in red clover is at least twice the number of members in M. truncatula. (B) GO-terms overrepresented and proportion of sequences observed in the expanded clusters (blue columns) versus expected/total (red columns). (C&D) Treemaps with the biological process GO terms (C) and Molecular activity GO terms (D). The area is proportional to the enrichment, so bigger areas represent highly overrepresented functions in red clover. 7A
16 7B
17 7C 7D
18 Figure 8. Red clover gene duplication events. Close events are represented together as thicker lines.
19 Figure 9. Gene duplication events in red clover. (A) Frequency of Gene duplication events with time (Kimura rates) between chromosomes in the red clover genome. (B) Frequency of Gypsy duplication events with time (Kimura rates) in the red clover and M. truncatula genomes.
20 Figure 10. Distribution of the distance from red clover genes to the closest Gypsy or Copia element, for the whole set of genes (Top panel) or duplicated gene pairs (Bottom panel).
21 Figure 11. Biosynthesis of formononetin in plants. Schematic representation of the (A) formononetin biosynthesis pathway and (B) formononetin interconversion pathway. B IF7GT Isoflavone 7-O-glucosyltransferase ( ) Formononetin 7-O-glucoside MAT7 Isoflavonoid malonyltransferase ( ) Formononetin 7-O-glucoside-6 -O-malonate
22 Figure 12. Phylogenetic tree of 2-hydroxyisoflavanone-dehydratase (HIDH) ( ) in red clover, soybean (Glyma), common bean (Phvu) and M. truncatula (Medtr). The outgroup is represented by A. thaliana carboxylesterase.
23 Figure 13. Spatial distribution of four clusters of genes encoding enzymes involved in formononetin biosynthesis in red clover and M. truncatula.
24 Figure 14. Phylogenetic tree of isoflavone synthase (IFS1) ( ) in red clover, soybean (Glyma), common bean (Phvu) and M. truncatula (Medtr). The AF gene from Pisum sativum provides the outgroup.
25 Figure 15. Phylogenetic tree of isoflavone O-methyltransferase (IOMT) ( ) in red clover, soybean (Glyma), common bean (Phvu) and M. truncatula (Medtr). AT4G and AT4G are outgroups from A. thaliana.
26 Figure 16. Phylogenetic tree of 2,7,4 -trihydroxyisoflavanone 4 -O-methyltransferase (HIOMT) ( ) in red clover, soybean (Glyma), common bean (Phvu) and M. truncatula (Medtr). AB091686_mRNA_Q84KK4_extraction from L. japonicus is the outgroup.
27 Figure 17. Phylogenetic tree of isoflavone 7-O-glucosyltransferase (IF7GT) ( ) in in red clover, soybean (Glyma), common bean (Phvu) and M. truncatula (Medtr). The outgroup is AT1G1040 from A. thaliana.
28 Figure 18. Phylogenetic tree of Isoflavonoid malonyltransferase (MAT7) ( ) in red clover, soybean (Glyma), common bean (Phvu) and M. truncatula (Medtr). The Ricinus communis gene is the outgroup.
29 Figure 19. Phylogenetic tree of PPO protein family in legume species. The three transcripts isolated from red clover by Sullivan et al (2004) 2 are in purple, the three extra transcripts proposed by Winters et al (2009) 3 are in orange, and the five genes in the red clover genome are in red. PPO genes identified in M. truncatula are indicated in blue. PPO2 genes from Populus balsamifera provide outgroups.
30 Figure 20. Microsynteny between M. truncatula and red clover in the PPO region.
31 Figure 21. Linkage disequilibrium in a synthetic population of red clover. A: Predicted decay of LD in the seven chromosomes of red clover. B: LD heatmap and landscape plots of the red clover chromosomes. The graphs were generated as described 50. A
32 B Chr 1 Chr 2 Chr 3 Chr 4
33 Chr 5 Chr 6 Chr 7
34 Figure 22. PCA analysis of red clover synthetic population. The analysis is based on GBS data for the 86 genotypes of the red clover variety Lea. The two populations were deduced from analysis using the STRUCTURE programme 4.
35 Figure 23. Outline of the annotation pipeline.
36 Supplementary Tables Table 1. Statistics of the WGS, final assembly and pseudo-molecules. Version Sequences Seqs N80 N50 N20 Max Total (Mb) Placed (Mb) (Total) >N50 WGS 347, , , ,424 1,636, (unfiltered) WGS 39, , , ,285 1,636, (>500bp) Final 39, , Mb 26.5 Mb Mb Pseudomolecules Mb 25.1 Mb 27 Mb 28.17Mb
37 Table 2. Analysis of the Kmers shared or unique between and within different assembly strategies. Assembly Reference: Alternative: Platanus ABySS Kmers 349,123, ,570,659 of the previous, are unique/distinct 279,627, ,174,661 (80.1%) (61.1%) Kmers found in the other assembly 330,745, ,166,458 (94,7%) (87.1%) Kmers NOT found in the other assembly 18,378,128 67,404,201 (5.3%) (12.9%) of the previous, are unique/distinct 18,113,106 57,660,671 (98.6%) (85.5%)
38 Table 3. Position and functional annotation of the genome (MS Excel file). Sheet1: Gene/transcripts annotation using Blast2GO, Uniprot homologous, Interpro, eggnog, and ORF description Sheet2: Transcripts correspondence in eggnog gene clusters, cluster function, cluster family. Sheet3: 1,253 transcripts in clusters expanded in red clover in comparison to M. truncatula.
39 Table 4. Classification and proportion of repetitive content in the red clover genome and comparison with other legume genomes. Superfamily Red clover Medicago truncatula Phaseolus vulgaris Glycine max Fraction Fraction Coverage Fraction Coverage Fraction Coverage genome in (bp) genome (bp) genome (bp) (% of pseudomolecules (% of (% of Mbp) (% of 164 Mbp) Mbp) Coverage (bp) Fraction genome (% of 955 Mbp) Mbp) Class 1 TEs Gypsy Copia SINEs LINEs Total Class Class 2 (DNA) TEs hat Harbinger/PIF MULE Stowaway Pogo CMC_EnSpm Helitron Other Total Class UnclassifTE Unclassif TE Non TEs Simple reps Satellites TOTAL
40 Table 5. Average pairwise linkage disequilibrium (r 2 ) in the seven red clover chromosomes at three distances. Chromosome Mb 0.1 Mb 0.5 Mb
41 Table 6. Shotgun short-read libraries used in the WGS. Library Reads EBI-ENA Accession PE (100 bp) 101.4e6 ERX PE (150 bp) 306.3e6 ERX SE (150 bp) 254.6e6 ERX946108, ERX Overlap PE (150 bp) 25.6e6 ERX Kb MP (100 bp) 224.8e6 ERX946085, ERX Kb MP (65 bp) 4.2e6 ERX Kb MP (100 bp) 20.4e6 ERX Kb MP (150 bp) 88.0e6 ERX All shotgun reads and the assembly are deposited in the European Nucleotide Archive (accession PRJEB9186). The genome assembly and annotation can also be downloaded as files ( or browsed online (
42 Supplementary References 1 Ištvánek, J., Jaroš, M., Křenek, A. & Řepková, J. Genome assembly and annotation for red clover (Trifolium pratense; Fabaceae). American Journal of Botany 101, (2014). 2 Sullivan, M. L., Hatfield, R. D., Thoma, S. L. & Samac, D. A. Cloning and Characterization of Red Clover Polyphenol Oxidase cdnas and Expression of Active Protein in Escherichia coli and Transgenic Alfalfa. Plant Physiology 136, (2004). 3 Winters, A. et al. Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover) using a large insert BAC library. BMC Plant Biology 9, 94 (2009). 4 Pritchard, J. K., Stephens, M. & Donnelly, P. Inference of Population Structure Using Multilocus Genotype Data. Genetics 155, (2000).
Supplemental Figure 1. Small RNA size distribution from different soybean tissues.
Supplemental Figure 1. Small RNA size distribution from different soybean tissues. The size of small RNAs was plotted versus frequency (percentage) among total sequences (A, C, E and G) or distinct sequences
RNA-Seq Atlas of Glycine max: A guide to the Soybean Transcriptome
RNA-Seq Atlas of Glycine max: A guide to the Soybean Transcriptome How do novel structures or functions evolve? A more relevant example Symbiosis and Nitrogen Fixation Limpens & Bisseling (23) Curr. Opin.
Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
IDENTIFICATION OF IN SILICO MIRNAS IN FOUR PLANT SPECIES FROM FABACEAE FAMILY
Original scientific paper 10.7251/AGRENG1803122A UDC633:34+582.736.3]:577.2 IDENTIFICATION OF IN SILICO MIRNAS IN FOUR PLANT SPECIES FROM FABACEAE FAMILY Bihter AVSAR 1*, Danial ESMAEILI ALIABADI 2 1 Sabanci
Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
Figure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022
96 APPENDIX B. Supporting Information for chapter 4 "changes in genome content generated via segregation of non-allelic homologs" Figure S1. Potential de novo CNV probes and sizes of apparently de novo
Analysis and characterization of the repetitive sequences of T. aestivum chromosome 4D
Analysis and characterization of the repetitive sequences of T. aestivum chromosome 4D Romero J.R., Garbus, I., Helguera M., Tranquilli G., Paniego N., Caccamo M., Valarik M., Simkova H., Dolezel J., Echenique
SUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION GO term analysis of differentially methylated SUMIs. GO term analysis of the 458 SUMIs with the largest differential methylation between human and chimp shows that they are more
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
Data mining with Ensembl Biomart. Stéphanie Le Gras
Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:
Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf. Rachel Schwope EPIGEN May 24-27, 2016
Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf Rachel Schwope EPIGEN May 24-27, 2016 What does H3K4 methylation do? Plant of interest: Vitis vinifera Culturally important
Global variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
Plant Cell Biology; Identification and manipulation of plant quality traits
Plant Cell Biology; Identification and manipulation of plant quality traits Phil Morris, Mark Robbins, Joe Gallagher and Ana Winters Mechanisms of protein protection in forages 30 Determining the constraints
Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
Nature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
Genomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
SUPPLEMENTARY INFORMATION
doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the
Nature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded from TCGA and differentially expressed metabolic genes
DNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints
Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide
Nature Methods: doi: /nmeth.3115
Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by
Supplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from
Supervised Learner for the Prediction of Hi-C Interaction Counts and Determination of Influential Features. Tyler Yue Lab
Supervised Learner for the Prediction of Hi-C Interaction Counts and Determination of Influential Features Tyler Derr @ Yue Lab tsd5037@psu.edu Background Hi-C is a chromosome conformation capture (3C)
CNV PCA Search Tutorial
CNV PCA Search Tutorial Release 8.1 Golden Helix, Inc. March 18, 2014 Contents 1. Data Preparation 2 A. Join Log Ratio Data with Phenotype Information.............................. 2 B. Activate only
Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
Accessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
Transcript reconstruction
Transcript reconstruction Summary I Data types, file formats and utilities Annotation: Genomic regions Genes Peaks bedtools Alignment: Map reads BAM/SAM Samtools Aggregation: Summary files Wig (UCSC) TDF
Supplementary Information. Supplementary Figures
Supplementary Information Supplementary Figures.8 57 essential gene density 2 1.5 LTR insert frequency diversity DEL.5 DUP.5 INV.5 TRA 1 2 3 4 5 1 2 3 4 1 2 Supplementary Figure 1. Locations and minor
Exercises: Differential Methylation
Exercises: Differential Methylation Version 2018-04 Exercises: Differential Methylation 2 Licence This manual is 2014-18, Simon Andrews. This manual is distributed under the creative commons Attribution-Non-Commercial-Share
fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
Genome mapping. Genome sequencing. Next Gen sequencing. Genome mapping. Genome sequencing Next Gen sequencing. YACs ~1 Mb.
Genome mapping 5-10 Mb Cytogene(c Band Genome sequencing Next Gen sequencing STS mapping fingerprint mapping YACs ~1 Mb BACs ~150 Kb Human Genome Gene9c Map Genome mapping Sequence- ready BAC map Genome
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies
MIR retrotransposon sequences provide insulators to the human genome
Supplementary Information: MIR retrotransposon sequences provide insulators to the human genome Jianrong Wang, Cristina Vicente-García, Davide Seruggia, Eduardo Moltó, Ana Fernandez- Miñán, Ana Neto, Elbert
Hands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
Ambient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
ChIP-seq data analysis
ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional
Nature Immunology: doi: /ni Supplementary Figure 1. RNA-Seq analysis of CD8 + TILs and N-TILs.
Supplementary Figure 1 RNA-Seq analysis of CD8 + TILs and N-TILs. (a) Schematic representation of the tumor and cell types used for the study. HNSCC, head and neck squamous cell cancer; NSCLC, non-small
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
Rice in vivo RNA structurome reveals RNA secondary structure conservation and divergence in plants
Rice in vivo RN structurome reveals RN secondary structure conservation and divergence in plants Hongjing Deng 1,2,,5, Jitender heema 3, Hang Zhang 2, Hugh Woolfenden 2, Matthew Norris 2, Zhenshan Liu
High coverage in planta RNA sequencing identifies Fusarium oxysporum effectors and Medicago truncatularesistancemechanisms
High coverage in planta RNA sequencing identifies Fusarium oxysporum effectors and Medicago truncatularesistancemechanisms Louise Thatcher Gagan Garg, Angela Williams, Judith Lichtenzveig and Karam Singh
BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
Unsupervised Identification of Isotope-Labeled Peptides
Unsupervised Identification of Isotope-Labeled Peptides Joshua E Goldford 13 and Igor GL Libourel 124 1 Biotechnology institute, University of Minnesota, Saint Paul, MN 55108 2 Department of Plant Biology,
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity
Supplementary Figure 1 Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity (a, b) Fluorescent-based determination of the binding capacity of DNA-barcoded MHC multimers (+barcode)
Transcriptome Analysis
Transcriptome Analysis Data Preprocessing Sample Preparation Illumina Sequencing Demultiplexing Raw FastQ Reference Genome (fasta) Reference Annotation (GTF) Reference Genome Analysis Tophat Accepted hits
Bioinformatics Laboratory Exercise
Bioinformatics Laboratory Exercise Biology is in the midst of the genomics revolution, the application of robotic technology to generate huge amounts of molecular biology data. Genomics has led to an explosion
Principles of phylogenetic analysis
Principles of phylogenetic analysis Arne Holst-Jensen, NVI, Norway. Fusarium course, Ås, Norway, June 22 nd 2008 Distance based methods Compare C OTUs and characters X A + D = Pairwise: A and B; X characters
EXPression ANalyzer and DisplayER
EXPression ANalyzer and DisplayER Tom Hait Aviv Steiner Igor Ulitsky Chaim Linhart Amos Tanay Seagull Shavit Rani Elkon Adi Maron-Katz Dorit Sagir Eyal David Roded Sharan Israel Steinfeld Yossi Shiloh
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
Shape-based retrieval of CNV regions in read coverage data. Sangkyun Hong and Jeehee Yoon*
254 Int. J. Data Mining and Bioinformatics, Vol. 9, No. 3, 2014 Shape-based retrieval of CNV regions in read coverage data Sangkyun Hong and Jeehee Yoon* Department of Computer Engineering, Hallym University
README file for GRASTv1.0.pl
README file for GRASTv.0.pl Genome Reduction Analysing Software Tool (GRAST). Produced by Christina Toft and Mario A. Fares Date 03/04/06 Reference and more information: Toft, C and Fares, MA (2006). GRAST:
Assignment 5: Integrative epigenomics analysis
Assignment 5: Integrative epigenomics analysis Due date: Friday, 2/24 10am. Note: no late assignments will be accepted. Introduction CpG islands (CGIs) are important regulatory regions in the genome. What
Looking Forward: Dry Bean Improvement in the Next 30 years!
Looking Forward: Dry Bean Improvement in the Next 30 years! Mark Brick Department of Soil and Crop Sciences Colorado State University, Fort Collins, CO 1 Common Bean (Phaseolus vulgaris L.) comes in many
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Kaifu Chen 1,2,3,4,5,10, Zhong Chen 6,10, Dayong Wu 6, Lili Zhang 7, Xueqiu Lin 1,2,8,
SUPPLEMENTARY APPENDIX
SUPPLEMENTARY APPENDIX 1) Supplemental Figure 1. Histopathologic Characteristics of the Tumors in the Discovery Cohort 2) Supplemental Figure 2. Incorporation of Normal Epidermal Melanocytic Signature
MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing
Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by
Problem 3: Simulated Rheumatoid Arthritis Data
Problem 3: Simulated Rheumatoid Arthritis Data Michael B Miller Michael Li Gregg Lind Soon-Young Jang The plan
EXTENDED DATA FORMATTING GUIDE
EXTENDED DATA FORMATTING GUIDE Nature paper but are included online within the full-text HTML and at the end of the online PDF. Nature separate panel (for example, see Extended Data Figure 2, panel d)
Nature Neuroscience: doi: /nn Supplementary Figure 1. Behavioral training.
Supplementary Figure 1 Behavioral training. a, Mazes used for behavioral training. Asterisks indicate reward location. Only some example mazes are shown (for example, right choice and not left choice maze
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
Discovery of Novel Human Gene Regulatory Modules from Gene Co-expression and
Discovery of Novel Human Gene Regulatory Modules from Gene Co-expression and Promoter Motif Analysis Shisong Ma 1,2*, Michael Snyder 3, and Savithramma P Dinesh-Kumar 2* 1 School of Life Sciences, University
SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab
SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA Giuseppe Narzisi, PhD Schatz Lab November 14, 2013 Micro-Assembly Approach to detect INDELs 2 Outline Scalpel micro-assembly pipeline
SUPPLEMENTARY DATA. 1. Characteristics of individual studies
1. Characteristics of individual studies 1.1. RISC (Relationship between Insulin Sensitivity and Cardiovascular disease) The RISC study is based on unrelated individuals of European descent, aged 30 60
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
MODULE 3: TRANSCRIPTION PART II
MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain
BST227 Introduction to Statistical Genetics. Lecture 4: Introduction to linkage and association analysis
BST227 Introduction to Statistical Genetics Lecture 4: Introduction to linkage and association analysis 1 Housekeeping Homework #1 due today Homework #2 posted (due Monday) Lab at 5:30PM today (FXB G13)
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
New Enhancements: GWAS Workflows with SVS
New Enhancements: GWAS Workflows with SVS August 9 th, 2017 Gabe Rudy VP Product & Engineering 20 most promising Biotech Technology Providers Top 10 Analytics Solution Providers Hype Cycle for Life sciences
RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays
Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,
ddm1a (PFG_3A-51065) ATG ddm1b (PFG_2B-60109) ATG osdrm2 (PFG_3A-04110) osdrm2 osdrm2 osdrm2
Relative expression.6.5.4.3.2.1 OsDDM1a OsDDM1b OsDRM2 TG TG TG ddm1a (PFG_3-5165) P1 P3 ddm1b (PFG_2-619) P2 531bp 5233bp P1 P4 P3 P2 F1 R1 F1 TG TG TG F1 R1 C ddm1a -/- -/- ddm1b -/- +/- +/- -/- D (PFG_3-411)
Supplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature
Supplemental Data Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Jianfu Jiang 1, Xinna Liu 1, Guotian Liu, Chonghuih Liu*, Shaohuah Li*, and Lijun
SEQUENCE FEATURE VARIANT TYPES
SEQUENCE FEATURE VARIANT TYPES DEFINITION OF SFVT: The Sequence Feature Variant Type (SFVT) component in IRD (http://www.fludb.org) is a relatively novel approach that delineates specific regions, called
Supplementary Figure 1
Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the
Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples.
Supplementary files Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples. Table S3. Specificity of AGO1- and AGO4-preferred 24-nt
SUPPLEMENTAL DATA AGING, July 2014, Vol. 6 No. 7
SUPPLEMENTAL DATA Figure S1. Muscle mass changes in different anatomical regions with age. (A) The TA and gastrocnemius muscle showed a significant loss of weight in aged mice (24 month old) compared to
Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
9700 BIOLOGY. Mark schemes should be read in conjunction with the question paper and the Principal Examiner Report for Teachers.
CAMBRIDGE INTERNATIONAL EXAMINATIONS GCE Advanced Subsidiary Level and GCE Advanced Level MARK SCHEME for the May/June 2013 series 9700 BIOLOGY 9700/31 Paper 31 (Advanced Practical Skills 1), maximum raw
Functional annotation of farm animal genomes: ChIP-seq.
Functional annotation of farm animal genomes: ChIP-seq Richard Crooijmans 2018, PAGXXVI Richard.Crooijmans@wur.nl Why FAANG is important Understanding the genotype to phenotype link This needs: - genomic
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
Figure 1: Final annotation map of Contig 9
Introduction With rapid advances in sequencing technology, particularly with the development of second and third generation sequencing, genomes for organisms from all kingdoms and many phyla have been
Below, we included the point-to-point response to the comments of both reviewers.
To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively
Nature Genetics: doi: /ng Supplementary Figure 1. Country distribution of GME samples and designation of geographical subregions.
Supplementary Figure 1 Country distribution of GME samples and designation of geographical subregions. GME samples collected across 20 countries and territories from the GME. Pie size corresponds to the
Supplementary Information
Supplementary Information 5-hydroxymethylcytosine-mediated epigenetic dynamics during postnatal neurodevelopment and aging By Keith E. Szulwach 1,8, Xuekun Li 1,8, Yujing Li 1, Chun-Xiao Song 2, Hao Wu
Cancer Informatics Lecture
Cancer Informatics Lecture Mayo-UIUC Computational Genomics Course June 22, 2018 Krishna Rani Kalari Ph.D. Associate Professor 2017 MFMER 3702274-1 Outline The Cancer Genome Atlas (TCGA) Genomic Data Commons
Expanded View Figures
Molecular Systems iology Tumor CNs reflect metabolic selection Nicholas Graham et al Expanded View Figures Human primary tumors CN CN characterization by unsupervised PC Human Signature Human Signature
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood
Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood tree illustrating CRF01_AE gp120 protein sequence relationships between 107 Envs sampled in the RV144 trial
P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
High Throughput Sequence (HTS) data analysis. Lei Zhou
High Throughput Sequence (HTS) data analysis Lei Zhou (leizhou@ufl.edu) High Throughput Sequence (HTS) data analysis 1. Representation of HTS data. 2. Visualization of HTS data. 3. Discovering genomic
Benchmark datasets for phylogenomic pipeline validation
Benchmark datasets for phylogenomic pipeline validation GenomeTrakr Meeting Sept. 2018 Ruth E. Timme, PhD Research Microbiologist GenomeTrakr data coordinator Validation for phylogenomics Phylogenomic
DNA Sequence Bioinformatics Analysis with the Galaxy Platform
DNA Sequence Bioinformatics Analysis with the Galaxy Platform University of São Paulo, Brazil 28 July - 1 August 2014 Dave Clements Johns Hopkins University Robson Francisco de Souza University of São
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control