SUPPLEMENTARY INFORMATION
|
|
- Warren Robbins
- 5 years ago
- Views:
Transcription
1 DOI: 1.138/nc3371 iecs iecs Dicer1 sictrl sidicer1 sictrl sidicer1 P =.5 c LPS+IFN-γ IFN-γ ibmms NT IL-4 d 2. Dicer1 2. Dicer1 FC vs sictrl sictrl sidicer1 25 kd kd kd 25 kd 1 kd FC vs CD11c + TAMs CD11c + TAMs MRC1 + TAMs CD11c + TAMs MRC1 + TAMs Supplementry Figure 1 Supplementry Figure 1 T helper cytokines modulte mcrophge. () qpcr nlysis of Dicer1 (normlized to Gpdh; fold-chnge (FC) versus sictrl; men vlues ±SEM) in immortlized endothelil cells (iecs) either trnsfected with control sirna (sictrl; n=4 iologiclly independent cell cultures) or nti-dicer1 sirna (sidicer1; n=4 iologiclly independent cell cultures). Sttistics y unpired Student s t test on ΔCt vlues. Cultures indicted y red circles/squres were lso nlyzed y Western lotting, s shown in (). () Western lot nlysis of nd vinculin () in the iecs indicted y red circles/squres in (). The experiments in () nd () were performed to vlidte the specificity of the nti- polyclonl ntiody used in our studies. (c) Western lot nlysis of nd in ibmms either not treted (NT) or treted s indicted. The lot ws proed with polyclonl nti- ntiody (top pnel) nd susequently re-proed with monoclonl nti- ntiody (middle pnel). is shown in the ottom pnel. (d) qpcr nlysis of Dicer1 (normlized to Gpdh; FC versus CD11c + TAMs; men vlues ±SEM) in MRC1 + nd CD11c + TAMs isolted from tretment-nïve (n=3 independently sorted TAM smples from 3 mice/group) or (n=4 independently sorted TAM smples from 4 mice/group). Sttistics s in (). Sttisticl significnce: **, p <.1; ***, p <.1. Unprocessed Western lots re shown in Supplementry Figure Mcmilln Pulishers Limited. All rights reserved
2 Blood Spleen Liver Lung Tumor 1 % GFP + cells LysM.Cre;mT/mG mt/mg WT Myeloid cells Clssicl monocytes Nonclssicl monocytes Lymphoid cells Myeloid cells Clssicl monocytes Nonclssicl monocytes/ mcrophges Lymphoid cells mt/mg GFP Tomto MRC1 DAPI Merged Myeloid cells Monocytes/ mcrophges Lymphoid cells Myeloid cells Monocytes Mcrophges Lymphoid cells Myeloid cells CD11c + TAMs MRC1 + TAMs Lymphoid cells CD45 - cells LysM.Cre;mT/mG Merged LysM.Cre;mT/mG GFP Tomto MRC1 DAPI Merged c 3 15 Clssicl monocytes 4 Nonclssicl monocytes 8 B cells CD8 + T cells CD4 + T cells 2 2 % of CD45 + cells D +/+ D -/- d 6 w 15 w N 6 w 15 w 6 w 15 w D -/- D +/+ D lox/lox M1 M2 T N M1 M2 T N M1 M2 T 6 w 15 w 6 w 15 w 6 w 15 w Dicer1 -/- lox/lox Dicer1 Dicer1 +/+ 6 p 5 p 3 p Supplementry Figure 2 A LysM-Cre trnsgene medites preferentil Dicer1 deletion in mcrophges. () Flow cytometry nlysis of GFP + immune cells in lood, spleen, liver, lung, nd tumors of -ering LysM-Cre;ROSA mt/mg mice (n=4 mice), ROSA mt/mg mice (n=4 mice) or wild-type (WT) control mice (2 mice). Dt show percentges (men vlues) of GFP + cells in ech of the indicted cell types. () GFP (green), Tomto (red), MRC1 (lue) nd DAPI (white) immunostining of tumors from ROSA mt/mg (upper pnel) or LysM-Cre;ROSA mt/mg (lower pnel) mice. Scle r, 2 µm. Imges re representtive of the tumors in (). (c) Flow cytometry nlysis of lood otined from D +/+ or D / mice of either 6 or 15 weeks of ge. Dt show percentges (men vlues ±SEM) of the indicted cell types. N=4 or 5 (D +/+ non-clssicl monocytes), 7 (D / non-clssicl monocytes), nd 8 (other D / cells) or 1 (other D +/+ cells) mice. Sttistics y unpired Student s t test. (d) PCR nlysis of genomic Dicer1 in neutrophils (N), CD11c + TAMs (M1), MRC1 + TAMs (M2), nd tumor-derived cells depleted of endothelil nd hemtopoietic cells (T), ll isolted from tumors of LysM-Cre;Dicer1 lox/lox (D / ), LysM-Cre;Dicer1 +/+ (D +/+ ), or Dicer1 lox/lox mice. Arrows indicte (i) genomic deletion of Dicer1 23 rd exon (Dicer / ); (ii) floxed ut not deleted Dicer1 23 rd exon (Dicer1 lox/lox ); nd (iii) wild-type Dicer1 locus (Dicer1 +/+ ). Sttisticl significnce: **, p <.1; ***, p <.1. Source dt for () re reported in Supplementry Tle Mcmilln Pulishers Limited. All rights reserved
3 FC vs D +/+ FC vs D +/ D +/+ D -/- D +/+ D -/- M1 TAMs M2 TAMs Monocytes P =.5 P =.4 *** *** *** ** ** ** c d e M1 TAMs M2 TAMs Monocytes P =.7 P =.9 P =.2 P =.2 P =.1 * ** 2. P =.3 P =.5 ** *** *** *** *** ** ** P =.5 P =.5 P =.6 ** ** P =.7 P = ** MMTV-PyMT 2.5 P =.5 P = N.D N.D.. P =.4 Blood leukocytes D +/+ D -/- D +/+ D -/- % of CD45 + cells D +/+ D -/- Clssicl monocytes Nonclssicl monocytes B cells CD8 + T cells Supplementry Figure 3 inctivtion in TAMs depletes mirnas nd inhiits tumor metstsis without disrupting hemtopoiesis. (, ) qpcr nlysis of mirnas (normlized to U6; FC vlues ±SEM) in CD11c + nd MRC1 + TAMs, Ly6G + neutrophils nd Ly6G Ly6C + monocytes, isolted from (n=4 independently sorted cell smples from 4 mice/group for ll cell types; n=3 for M1 TAMs in D / ) or (n=3 independently sorted cell smples from 3 mice/group) tumors of either D / or D +/+ mice. Sttistics y unpired Student s t test on ΔCt vlues. N.D., not detected. Note tht the -ering mice in Fig. 2 nd Supplementry Fig. 3 elong to independent experiments. (c, d) Representtive imges of lungs showing spontneous (c) nd experimentl MMTV-PyMT (d) micrometstses. Arrows indicte selected micrometstses. Scle r, mm. (e) Percentge of the indicted hemtopoietic cell types (men vlues ±SEM) in tumor-ering D / (n=7) or D +/+ (n=11) mice. Sttistics y two-wy ANOVA. Sttisticl significnce: **, p <.1; ***, p < Mcmilln Pulishers Limited. All rights reserved
4 MMTV-PyMT lymphoid myeloid F4/8 low MDSCs F4/8 high TAMs F4/8 high TAMs F4/8 low MDSCs CD11c + TAMs MRC1 + TAMs IgG α CSF1R CD45 CD45 CD11 CD11 CD11 F4/8 Ly6G Ly6G Ly6C Ly6G Ly6G Ly6C % of CD45+ cells P =.6 *** *** D +/+ ; α-csf1r D -/- ; α-csf1r P =.4 *** *** D +/+ ; α-csf1r D -/- ; α-csf1r CTc e Tumour weight (FC vs D +/+ ;IgG) D +/+ ; α-csf1r D -/- ; α-csf1r CD11 F4/8 *** ** 2. P =.7 3 P =.7 Tumour weight (FC vs D +/+ ;IgG) Ly6C P = ** 15 *** D +/+ D +/+ ; α-csf1r D -/- ; α-csf1r d FC vs D +/+ + Splenic CD8 T cells 2.. Ly6C + Splenic CD8 T cells Let7 D +/+ D -/- Let7d-5p mir-22-3p mir-125-5p D -/- CT+ % of CD45 + cells CD11c + TAMs 25 ** ** D +/+ ; α-csf1r D -/- ; α-csf1r MRC1 + TAMs *** 4 P =.3 ** D +/+ ; α-csf1r D -/- ; α-csf1r Dicer1 -/- lox/lox Dicer1 Dicer1 +/+ 5 p 3 p Supplementry Figure 4 deficiency induces pro- to nti-tumorl TAM conversion. () Flow cytometry nlysis of immune cells in MMTV- PyMT tumors, treted s indicted. One representtive tumor per condition (of 7 nlyzed) is shown. The two mother dot plots on the left (upper nd ottom rows) disply n equl numer of events. MDSC, myeloid-derived suppressor cells comprising Ly6G + neutrophils, Ly6C + monocytes nd Ly6G Ly6C immture myeloid cells. () Percentge (men vlues ±SEM) of CD11c + nd MRC1 + TAMs in D / or D +/+ mice, treted s indicted. : n=9 (), 9 (D +/+ ; nti-csf1r), 5 (D / ; IgG), nd 11 (D / ; nti-csf1r) mice; : n=7 (), 7 (D +/+ ; nti-csf1r), 6 (D / ; IgG), nd 6 (D / ; nti-csf1r) mice. Sttistics y Mnn-Whitney U test. (c) Tumor weight (FC versus D +/+, IgG; men vlues ±SEM) in D / or D +/+ mice, treted s indicted. : n=1 (), 9 (D +/+ ; nti-csf1r), 11 (D / ; IgG), nd 11 (D / ; nti-csf1r) mice; : n=17 (), 17 (D +/+ ; nti-csf1r), 13 (D / ; IgG), nd 16 (D / ; nti-csf1r). Right pnel comines the dt from 2 independent experiments. Sttistics y unpired Student s t test. (d) qpcr nlysis of mirnas (normlized to U6, FC versus D +/+ ; men vlues ±SEM) in CD8 + T cells isolted from the spleen of D / or D +/+ mice (n=3 independently sorted T-cell smples from 3 mice/group). Sttistics y unpired Student s t test on ΔCt vlues. (e) PCR nlysis of genomic Dicer1 in CD8 + T cells isolted from the spleen of D +/+ or D / mice (n=3 independently sorted T-cell smples from 3 mice/group). Arrows indicte (i) genomic deletion of Dicer1 23 rd exon (Dicer1 / ); (ii) floxed ut not deleted Dicer1 23 rd exon (Dicer1 lox/lox ); nd (iii) wild-type Dicer1 locus (Dicer1 +/+ ). CT, wild-type llele (BMDM mcrophges); CT +, deleted llele (Dicer1 knockout iec clone). Sttisticl significnce: **, p <.1; ***, p <.1. Source dt for (c) re reported in Supplementry Tle Mcmilln Pulishers Limited. All rights reserved
5 CD8 + T cells 5 P =.3 *** CD8 DAPI Merged CD8 DAPI Merged # CD8 + cells per field D +/+ ; α-cd8 CD8 DAPI Merged D -/- ; α-cd8 CD8 DAPI Merged D +/+ ; α-cd8 D -/- ; α-cd8 Supplementry Figure 5 Anti-CD8 ntiodies deplete tumor CTLs. () Immunostining of tumors of D +/+ or D / mice, treted s indicted. Dt show the numer of CD8 + cells per field (men vlues ± SEM). Only tumor res with reltively undnt CD8 + T cells were imged nd nlyzed. N=8 (), 6 (D +/+ ; nti-cd8), 4 (D / ; IgG), nd 6 (D / ; nti-cd8) mice. Sttistics y unpired Student s t test. () Representtive imges from (). CD8 (red) nd DAPI (lue). Scle r 5 µm. Sttisticl significnce: **, p <.1; ***, p < Mcmilln Pulishers Limited. All rights reserved
6 p vlue % CI mir-155-5p Cumultive frction Whole trnscriptome mir-155-5p trgets p <.1 Whole trnscriptome -5p trgets logfc (mir-155 -/- vs mir-155 +/+ B cells) logfc (mir-155 -/- vs mir-155 +/+ B cells) logfc (mir-155 -/- vs mir-155 +/+ B cells) c p vlue % CI -3p d Cumultive frction Whole trnscriptome -3p trgets p <.1 Whole trnscriptome -5p trgets logfc ( -/- vs +/+ neutrophils) logfc ( -/- vs +/+ neutrophils) logfc ( -/- vs +/+ neutrophils) e 516 #pre-mirnas inferred to e ctivted y Dicer deletion #pre-mirnas inferred to e inhiited y Dicer deletion f Activity score Top 1 mirnas inhiited y Dicer deletion g D -/- vs D +/+ (log 2 fold chnge) Genes negtively correlted to hs-let-7e in TCGA AML #pre-mirnas with nonsignificnt ctivity score (p>.5) Supplementry Figure 6 Bioinformtics nlyses identify Let-7 s cndidte mirna. (, c) Volcno plots showing the distriution of mirnas sed on the FC of their top-3 predicted trgets (ccording to TrgetScnssigned score). Dt in () show mir-155 / versus mir-155 +/+ B-cells fter 48h of LPS, IL-4 nd α-cd4 tretment (GSM nd GSM ; re-nlysis in GSE6426); dt in (c) show / versus +/+ neutrophils (GSE6426). p vlues were otined y Kolmogorov-Smirnov test (versus whole trnscriptome). Confidence intervl (CI) ws otined y rndomly resmpling of ~1 4 mirna:trget interctions. (, d) Cumultive distriution of logfc vlues of the top-3 predicted trgets. Dt in () show mir-155 / versus mir-155 +/+ B-cells; dt in (d) show / versus +/+ neutrophils. The red line indictes the logfc of trgets for the indicted mirnas. The ck line indictes the logfc in the whole trnscriptome. Sttistics y Kolmogorov-Smirnov test. (e) Numer of premirnas inferred to hve (or not) ctivity ffected y Dicer deletion in TAMs. (f) Top-1 mirnas with ctivity predicted to e inhiited y Dicer deletion in TAMs. Rnking is sed on the ctivity scores otined from the AML TCGA signture-sed mirna ssocition study. (g) Genes negtively correlted to hs-let-7e in the AML TCGA signture-sed mirna ssocition study. Dt show genes with significnce level of p<.5 nd RPKM>1 in t lest one smple. Note tht 13/18 genes show concordnt deregultion in the AML TCGA nd D / versus D +/+ TAM dtsets Mcmilln Pulishers Limited. All rights reserved
7 iecs D -/- iecs D +/+ f Tumour volume (mm 3 ) mirt-142 No mirt mirt-142 No mirt LV-miR-511 Overexpression LV-control LV- LV-miR-142 Overexpression OFP Dys post-tumour chllenge LV-miR-142 Overexpression Dicer1 independent mirt - GFP d % of CD45 + cells ckit + Sc1 - progenitor cells Hemtopoietic mrking % mo2 + in CD45 + cells LV-control LV- BM nlysis of trnsplnted D -/- mice GMP emep EP MPP1 MPP2 HSC c % of CD45 + cells e % of CD45 + cells Blood nlysis of trnsplnted D -/- mice LV-control LV- Clssicl monocytes Nonclssicl monocytes CD4 + T cells CD8 + Tcells B cells Blood nlysis of trnsplnted D -/- mice 5 LV-control 4 LV- Clssicl monocytes Nonclssicl monocytes CD4 + T cells CD8 + T cells B cells Supplementry Figure 7 Rescue of -5p ctivity in TAMs opposes the effects of inctivtion. () Flow cytometry nlysis showing D +/+ or D / iecs 2 trnsduced with either n LV expressing GFP trnsgene with rtificil trget sequences for (mirt-142-3p reporter) or control LV expressing GFP (no mirt). Trnsduced cells were then superinfected with LVs to overexpress mir-511 (LV-miR-511), mir-142 (LV-miR-142) or hyrid mir-451/ (LV-miR-142 / Dicer independent), together with OFP. Note tht the Dicer-independent mir- 451/142-3p LV, ut not LV expressing the wild-type, efficiently suppressed GFP in D / iecs, which do not express endogenously. (, c) Percentge (men vlues ±SEM) of lood OFP + CD45 + cells () or distinct hemtopoietic cell types (c) in mice reconstituted with D / HS/PCs previously trnsduced with the indicted LVs, nd nlyzed t 6 weeks post-hs/pc trnsplnt. N=4 (LV-) nd 8 (LV-control) mice. Sttistics y unpired Student s t test () or two-wy ANOVA (c). (d, e) Percentge (men vlues ±SEM) of hemtopoietic cell types in the BM (d) or lood (e) of tumor-ering mice tht hd een reconstituted with HS/ PCs trnsduced with the indicted LVs. N=4 (d) or 3 (e) mice for LV-, nd 8 for LV-control. Sttistics s in (c). (f) Tumor volume (men vlues ±SEM) in -ering mice, previously reconstituted with D / HS/PCs trnsduced s indicted. N=4 (LV-) nd 8 (LV-control) mice. Sttistics s in (c) Mcmilln Pulishers Limited. All rights reserved
8 ibmms BMDMs kd 25 kd 25 kd 15 kd 25 kd 1 kd 15 kd 75 kd 1 kd 1. NT 3. LPS+IFNγ 2. IFNγ 4. IL-4 75 kd 1. NT 3. IL-4 2. LPS+IFNγ c sictrl sidicer1 iecs sictrl sidicer1 d ibmms kd 15 kd Ct: 1352; Acm Rit polyclonl ntiody nti- 25 kd 15 kd 1 kd 75 kd 5 kd ct: ; Acm Mouse monoclonl ntiody nti- [S167-7] 25 kd 15 kd e ibmms 1 kd UT LV-LIN28A UT LV-LIN28A 25 kd 15 kd 75 kd 75 kd 5 kd 5 kd 37 kd 1. LPS+IFNγ 3. NT 2. IFNγ 4. IL-4 LIN28A 25 kd Short exposure Long exposure Supplementry Figure 8 Source dt for Western lots. Unprocessed lots re shown for the Western lots of Figures 1 ( nd ), Supplementry Figure 1-c (c nd d), nd Figure 7k (e) Mcmilln Pulishers Limited. All rights reserved
9 Upstrem Regultor Z-score P-vlue Trget molecules in dtset Upstrem ctivtors Cd86, Cxcl1, Cxcl11, Cxcl16, Cxcr3, Fn1, Il18p, Irf8, Ly6 IFNγ E-3 (includes others) Angpt2, Axl, Ccnd2, Cd14, Cd86, Cecm1, Csf3r, Cxcl1, Cxcl11, STAT Cxcr3, Fm26f, Fgl2, Fos, Gzm, Ifi47, Il15r, Il18p, Irf8, Itgx, 2.2E-8 Neurl3, Pprg, Retnl, Serpin3g (includes others), Smd7, Sp11, Tp1, Tgtp1/Tgtp2, Tlr9 IL Ccnd2, Cd14, Cd63, Cd86, Cxcl1, Fos, Gzm, Hl-A, Il15r, Il18p, 4.8E-4 Tp1, Tnfsf14 PARP E-2 Cxcl1, Dyx1c1, Fos, Il18p, Itgl, Tgtp1/Tgtp2, Timp2 IRF Cxcl1, Fm26f, Ifi47, Il15r, Il27, Irf8, Itgx, Prp12, Tp1, Tp2, 4.6E-3 Trf1, Zp1 IRF Bk1, Cecm1, Cxcl1, Cxcl16, Fgl2, Fpr2, Il12r1, Il18p, Il27, 2.7E-4 Odc1, Stt3, Tp1, Tp2, Tlr9 IRF Cd86, Cxcl1, Cxcr3, Fm26f, Hl-F, Ifi47, Il27, Prp12, Plcg2, Prnp, 1.8E-3 Sorl1, Tp1, Zp1 Upstrem Inhiitors STAT Ccl17, Ccnd2, Cd2, Cd38, Crip1, Cxcl1, Ephx1, Fcgr3/Fcgr3, 4.4E-4 Gzm, Hck, Lgls3p, Lpin2, Ly6 (includes others), Prnp, Retnl, Selenp1, Serpin6, Serpine1, Tgtp1/Tgtp2 Ac2, Acss1, Actn1, Adk, Alox5, Anx2, Aqp1, Arl4, Ass1, Axl, Cv1, Ccnd2, Cd14, Cd27, Cd3, Cd86, Cecm1, Cnih1, TGFB Cspg4, Ctnn1, Ctsh, Ctsk, Cxcl1, Cxcr3, Cxcr6, Dpk1, Dnpep, Dpysl3, Elf4, Fcgr3/Fcgr3, Fn1, Fos, Fos, Foxo1, Fpr2, Fut7, Gmpr, Gn4, Gn5, Gns, Gzm, Hnmt, Hnrnpdl, Icm2, Itgl, Itgx, 1.6E-9 Kitlg, Klf4, Klf9, Krs, Ldh, Ltc4s, Ly6 (includes others), Lyve1, Mn22, Mo, Mpkpk2, Mrk3, Mgt5, Mgmt, Myo1, Nt6, Ndst1, Nr1h3, Prp3, Pdpn, Pecm1, Pik3cd, Pmep1, Pprg, Psmc1, Ptk2, Rp1, Rhoc, Runx3, S14, Scr1, Selenp1, Sem4, Serpine1, Slc254, Smd7, Stt3, Stt5, Tgm2, Timp1, Timp2, Tnfrsf14, Tpst2, Trf1, Tsc22d3, Tu1, Vsp, Yx1 IL Ccl17, Ccnd2, Cd14, Cd2, Cd86, Cecm1, Cr1l, Cxcl1, Cxcr3, 2.1E-4 Fcgr3/Fcgr3, Fos, Fpr1, Il27, Itgl, Kitlg, Mmp8, Ptpn1, Slc93r2, Stt3, Tp1, Tp2, Timp1, Tlr9, Tsc22d3 Supplementry Tle 1: Upstrem regultor nlysis performed y Ingenuity Pthwy Anlysis. The tle shows the upstrem regultor nme, Z-score, p vlue, nd trget downstrem molecules in the dt-set (D / versus D+/+ TAMs). Light red: selected upstrem ctivtors. Light lue: selected upstrem inhiitors Mcmilln Pulishers Limited. All rights reserved
10 Function nnottion Chemotxis of ntigen presenting cells Antiody response Cell movement of lymphocytes Cytotoxicity of nturl killer cells Quntity of T lymphocytes Cytotoxicity of lymphocytes Adhesion of T lymphocytes Size of digestive orgn tumor Chemotxis of neutrophils Activtion of nturl killer cells Acute inflmmtion of tissue Z-score P-vlue Associted genes E E E E E E E-5 Ador3, Cd38, Cxcl1, Cxcr3, Fpr1, Fpr2, Il12r1, Il16, Jmjd6, Pik3cd, Plcg2, Plec, Ptk2, S14 Blnk, Cd18, Cd37, Cd38, Cd59, Cd86, Irf8, Itgl, Nod1, Pik3cd, Pprg, S1pr2, Stt3, Tlr9, Tnfrsf21, Trem2 Ackr3, Alox5, Anx1, Ccl17, Cd1d, Cd2, Cd59, Cd86, Cecm1, Cxcl1, Cxcl11, Cxcl16, Cxcr3, Elf4, Etv6, Fn1, Fos, Foxo1, Fut7, Fy, Hl-A, Icm2, Il15r, Il16, Il18p, Itg9, Itgl, Krs, Ltr, Ly6 (includes others), Nqo2, Pecm1, Pik3cd, Pip5k1c, Plc2, Plec, Ptpr, Rp1, S14, S1pr2, Stt3, Stt5, Tgm2, Timp1, Timp2, Tlr9, Tnfrsf14, Tnfrsf21, Tnfsf14 Cd2, Cd244, Cd3, Cd38, Cecm1, Fcgr3/Fcgr3, Fn1, Il27, Itgl, Kitlg, Plcg2, Ptk2, Stt5, Tlr9 Btf3, Cd1d, Cd244, Cd59, Cd86, Coro1, Cxcl1, Cxcl16, Cxcr3, Def6, Dilo, E2f2, Elf4, Etv6, Fos, Fos, Foxo1, Fy, Gm1587/Hmgn5, Gzm, Hl, Il15r, Il27, Irf8, Itgl, Kitlg, Klf4, Ltr, Mn21, Mp, Nlrc5, Npy, Pik3cd, Pprg, Prnp, Rd52, Ripk3, Runx3, S1pr2, Serpin6, Sirp, Slc66, Stt3, Stt5, Tp1, Tcf4, Tlr9, Tnfrsf21, Twsg1 Cd1d, Cd2, Cd244, Cd3, Cd38, Cecm1, Dilo, Fcgr3/Fcgr3, Fn1, Gzm, Hl, Ifngr2, Il27, Itgl, Kitlg, Plcg2, Ptk2, Sp17, Stt5, Tp2, Tlr9 Anx1, Ccl17, Cd2, Cxcr3, Fn1, Fut7, Fy, Icm2, Itgl, Ly6 (includes others), Pecm1, Pip5k1c E-4 Dilo, Iqgp2, Krs, Ltr, Prkc E E-4 Alox5, Cpg, Coro1, Csf3r, Cxcl1, Fer, Fpr1, Fpr2, Hck, Itg9, Lsp1, Mpkpk2, Mpp1, Pik3cd, Pip5k1c, Prkc Cd1d, Cd2, Cd244, Cd86, Fcgr3/Fcgr3, Gzm, Il12r1, Il15r, Itgl, Npy, Pik3cd, Stt5, Tlr E-4 Ador3, Alox5, Cd1d, Fpr2, Ntn1, Ptk2, Serpine1 Supplementry Tle 2: Biologicl function nlysis performed y Ingenuity Pthwy Anlysis. The tle shows the function nnottion, Z-score, p vlue, nd trget downstrem molecules in the dt-set (D / versus D+/+ TAMs) Mcmilln Pulishers Limited. All rights reserved
11 Synthetic mir-451 ckone Bckone for mirna overexpression: Sense TCGACGTTTGCAGCAGAGATGCAGAAGTACACG GGCTCACTGCTCGGCCTAATCAAGCCTGCTGAC AGCTGTGGCACTTGGGAATGGC GAGGCGAGA CGAGTCTGCACGTCTCG TCTTGCTGCTCCCAC AAACTGTGCCAAGAAGAGCTCATGACCCTGGAG CAGACTGCTGGAAGAAAAGGACACCCAGGCTG ACAAGG Oligos for mirna cloning: Sense Antisense _A GAGGTGTAGTGTTTCCTACTTTA AAGAAGTAGTGTTTCCTACTTTA _B TGGATAAAGTAGGAAACACTACT TCCATAAAGTAGGAAACACTACA -5p_A GAGGAGAGGTAGTAGGTTGCAT AAGATGAGGTAGTAGGTTGCAT -5p_B AGTTATGCAACCTACTACCTCA AACTATGCAACCTACTACCTCT Primers for mrna cloning: Sense Antisense LIN28A AAAAAGGATCCCTTTGCCTCCGGACTTCTCTGG AAAAAGTCGACAAAGACAGGGTGACACTGGGA TqMn proes for mirna expression: mirna Assy ID Provider U6 ID: 1973 Life Technologies mir- 15-5p ID: 389 Life Technologies mir- 16-5p ID: 391 Life Technologies mir- 21-5p ID: 397 Life Technologies mir- 22-3p ID: 398 Life Technologies mir p ID: 2198 Life Technologies mir p ID: 464 Life Technologies mir p ID: 468 Life Technologies mir p ID: 2295 Life Technologies mir p ID: Life Technologies Let- 7-5p ID: 377 Life Technologies Let- 7d- 5p ID: 2283 Life Technologies Let- 7e- 5p ID: 246 Life Technologies TqMn proes for mrna expression: mrna Assy ID Provider Ccl17 Mm516136_m1 Life Technologies Cd8 Mm118217_g1 Life Technologies Cd86 Mm444543_m1 Life Technologies Cxcl9 Mm434946_m1 Life Technologies Cxcl1 Mm445235_m1 Life Technologies Cxcr3 Mm _s1 Life Technologies Dicer1 Mm521722_m1 Life Technologies Gzm Mm442834_m1 Life Technologies Gpdh Mm _g1 Life Technologies Hprt Mm _m1 Life Technologies Ifng Mm _m1 Life Technologies Irf8 Mm492567_m1 Life Technologies Itgx Mm498698_m1 Life Technologies Mrc1 Mm485148_m1 Life Technologies Stt1 Mm439531_m1 Life Technologies Prf1 Mm812512_m1 Life Technologies Supplementry Tle 3: Nucleotide sequences nd TqMn ssys The tle shows the nucleotide sequence of the mir-451 ckone, dditionl sequences used to clone mirnas or cdnas of interest in LV contructs nd TqMn ssys used to quntify mirna nd mrna expression Mcmilln Pulishers Limited. All rights reserved
12 Antiody Provider Clone or ntiody ID Flow cytometry Immunofluorescence Western lotting stining Acm Rit polyclonl (ct 1352) WB Acm Mouse monoclonl (ct ) WB Acm EPR8185 WB CD11c BD HL3 IF CD31 BD Mec13.3 FC CD45 BD 3-f11 FC ckit BD 28 FC Fc lock BD 2.4j2 FC Rt IgG2 BD R35-95 FC LY6G BD 18 FC SCA1 BD B7 FC CD11 BioLegend M1-7 FC CD11c BioLegend N418 FC CD15 BioLegend TC15-12f12.2 FC CD19 BioLegend 6d5 FC CD4 BioLegend Rm4-5 FC CD45 BioLegend 3-f11 FC LIN28A Cell Signling A177 WB CD86 BioLegend GL-1 FC PDL-1 (CD274) ebioscience MIH5 FC Armenin hmster IgG BioLegend HTK888 FC CD45.1 BioLegend A2 FC CD48 BioLegend HM48-1 FC CD8 BioLegend FC F4/8 BioLegend Bm8 FC IF GR1 BioLegend RB6-8C5 FC Hmster IgG BioLegend HTK888 FC Mouse IgG1 κ BioLegend MOPC21 FC Rt IgG1 κ BioLegend Rtk271 FC LY6C BioLegend HK1.4 FC LY6G BioLegend 18 FC MRC1 BioLegend C68C2 FC IF NK1.1 BioLegend PK136 FC B22 ebioscience RA3-6B2 FC CD45 ebioscience 3-f11 FC CD45.2 ebioscience 14 FC GATA3 ebioscience Twj FC Mouse IgG1κ ebioscience P FC Rt IgG2 κ ebioscience ebr2a FC TBET ebioscience Eio4B1 FC TCRβ ebioscience H FC Anti-rit GE Helthcre Donkey polyclonl HPR WB Anti-mouse GE Helthcre Sheep polyclonl HPR WB MHC dextrmer H-2 K Immudex NA FC CD8 Life Technologies 5H1 FC IF CD8 Life Technologies YTS169.4 FC IF DAPI Life Technologies FC Live/Ded Life Technologies FC 7-AAD Sigm Aldrich FC Supplementry Tle 4: Antiodies for flow cytometry, immunofluorescence stining, nd Western lotting. The tle lists ll ntiodies used in this study, including clone (when pplicle) or the ntiody identifiction nme, s well s the specific pplictions Mcmilln Pulishers Limited. All rights reserved
13 Supplementry Tle 5: Sttistics source dt. The tle contins selected source dt for Fig. 3, 3c, 4c, 7d, 7e, 8, nd Supplementry Fig. 2 nd 4c. These re relted to experiments in which sttistics were not derived in the figures nd ssocited legends, or represent independent dt-sets from figures in which the results show comined dtsets. See figure legends for detils Mcmilln Pulishers Limited. All rights reserved
TNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationSUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationsequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
More informationSUPPLEMENTARY INFORMATION
DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3
More informationSupplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationMicrotubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
More informationSupplementary Information
Supplementry Informtion Cutneous immuno-surveillnce nd regultion of inflmmtion y group 2 innte lymphoid cells Ben Roediger, Ryn Kyle, Kwok Ho Yip, Nitl Sumri, Thoms V. Guy, Brin S. Kim, Andrew J. Mitchell,
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationSupplemental Information. Lymphocytes Negatively Regulate NK Cell Activity. via Qa-1b following Viral Infection
Cell Reports, Volume 21 Supplementl Informtion Lymphocytes Negtively Regulte NK Cell Activity vi Q-1b following Virl Infection Hifeng C. Xu, Jun Hung, Aleksndr A. Pndyr, Elisbeth Lng, Yun Zhung, Christine
More informationSupplementary Figure 1 a
% DAPI + Are Supplementry Figure 1 MOI 1 MOI.5 MOI.25 5 4 3 MOPC MOPC, LCMV reltive VL4 expression 2 1 d1 d2 d3 MOI.125 MOI.625 untreted Supplementry Figure 1: LCMV replictes in MOPC without ffecting cell
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationEosinophils! 40! 30! 20! 10! 0! NS!
A Macrophages Lymphocytes Eosinophils Neutrophils Percentage (%) 1 ** 4 * 1 1 MMA SA B C Baseline FEV1, % predicted 15 p = 1.11 X 10-9 5 CD4:CD8 ratio 1 Supplemental Figure 1. Cellular infiltrate in the
More information% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationSUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
More informationSupplementary Figure 1
Supplementry Figure 1 Ncor1 Expression 2. 1.5 1..5. Muscle Liver Lmi Ppropi Kindey Pncres Lung Testis Bone Mrrow Thymus Spleen Peripherl Lymph nods Smll Intestine Ncor1 Expression 1.5 1..5. DN DP SP CD8
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
More informationBezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1
More informationSUPPLEMENTARY INFORMATION
DOI:.3/nc37 This Supplementry Informtion file ws updted with new reference (ref. 3) on Decemer WWW.NATURE.COM/NATURECELLBIOLOGY Mcmilln Pulishers Limited. All rights reserved logfc SUPPLEMENTARY INFORMATION
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09663 Scrmle shnlrp3 shcsp1 IL-1β (p17) IL-1β (pg/ml) 2000 1500 1000 500 Wt Nlrp3-/- Ipf-/- 0 APDC IL-1β (p17) Supplementl Figure 1. Mitochondril ROS cn trigger NLRP3 inflmmsome ctivtion,
More informationSUPPLEMENTARY INFORMATION
Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationESM Table 1. Characterisation of the human non-diabetic cohort used for MRIbased assessment of pancreatic fat and insulin secretion via OGTT.
ESM Tle 1. Chrcteristion of the humn non-dietic cohort used for MRIsed ssessment of pncretic ft nd insulin secretion vi OGTT. Trit sex Medin (IQR) 86 femles, 5 mles ge (yers) 4.4 (.5-5.57) BMI (kg/m²).62
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationType II monocytes modulate T cell-mediated central nervous system autoimmunity
Type II monocytes modulte T cell-medited centrl nervous system utoimmunity Mrtin S. Weer, Thoms Prod homme, Swsn Youssef, Shnnon E. Dunn, Cynthi D. Rundle, Lind Lee, Jun C. Ptrroyo, Olf Stüve, Rymond A.
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
More informationSupplementary Figure 1. Flow cytometry panels used for BD Canto (A) and BD Fortessa (B).
Intra Immune nalysis Surface Supplementary Figure 1. Flow cytometry panels used for D Canto () and D Fortessa (). Name Fluorochrome ID F488 PE PerCp-Cy5.5 PC Paclue PE-Cy7 PC-H7 Lympho* 1 CD56 CD8 CD16
More informationSUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
More informationImtiyaz et al., Fig. S1
. Imtiyaz et al., Fig. S1 1. 1.1 1% O.1.5 Lin/Sca-1/IL-7Rα GMPs.17 MPs.3 Days 3% O.1 MEPs.35 D3 Days 1, N, N, H, H 1 1 Days Supplemental Figure S1. Macrophage maturation, proliferation and survival are
More informationSupplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION CD169 + MACROPHAGES PRESENT LIPID ANTIGENS TO MEDIATE EARLY ACTIVATION OF INVARIANT NKT CELLS IN LYMPH NODES Ptrii Brrl, Polo Polzell, Andres Brukuer, Nio vn Rooijen, Gurdyl S.
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.
Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative
More informationChronic variable stress activates hematopoietic stem cells
SUPPLEMENTARY INFORMATION Chronic variable stress activates hematopoietic stem cells Timo Heidt *, Hendrik B. Sager *, Gabriel Courties, Partha Dutta, Yoshiko Iwamoto, Alex Zaltsman, Constantin von zur
More informationMERS coronavirus induces apoptosis in kidney and lung by upregulating Smad7 and FGF2
ARTICLE NUMBER: 164 DOI: 1.138/NMICROBIOL.216.4 MERS coronvirus induces poptosis in kidney nd lung y upregulting Smd7 nd FGF2 Mn-Lung Yeung, Ynfeng Yo, Lilong Ji, Jsper F. W. Chn, Kwok-Hung Chn, Kwok-Fn
More informationSupplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis
Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis rasseit and Steiner et al. .. Supplementary Figure 1 % of initial
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationIL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia
Supplementary Figures IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Yaming Wang, Kristy J. Szretter, William Vermi, Susan Gilfillan, Cristina
More information11/7/2011. Disclosures. Psoriatic Arthritis (PsA) DC-STAMP I II III IV. None
unstimulte stimulte 11/7/11 Ientifiction of Unique Suset + (Denritic Cell-Specific Trnsmemrne Protein) T cells with Th17 Signture in Psoritic rthritis () Ptients Disclosures None Y.H. Chiu, E.M. Schwrz,
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationAMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis
SUPPLEMENTARY INFORMATION AMPK mintins energy homeostsis nd survivl in cncer cells vi regulting p38/pgc-1α-medited mitochondril iogenesis Blkrishn Chue 1, Prmnnd Mlvi 1, Shivendr Vikrm Singh 1, Noshd Mohmmd
More informationSupplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationL1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
More informationSupplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells
Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
More informationSUPPLEMENTARY INFORMATION
doi:.38/nture99 Dy Dy Dy 3 Dy 4 Bleed INDO INDO INDO INDO INDO INDO INDO INDO 3 7 CFU-GM/ml lood 6 4 3 Indomethcin Biclein + Indo + Bcln c WBC PMN LYMPH MONO RBC PLT Ctrl 7.4±.9.4±.8.4±.39.37±.6 8.88±.
More informationSupplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils
More informationSupplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
More informationNature Immunology: doi: /ni Supplementary Figure 1. Examples of staining for each antibody used for the mass cytometry analysis.
Supplementary Figure 1 Examples of staining for each antibody used for the mass cytometry analysis. To illustrate the functionality of each antibody probe, representative plots illustrating the expected
More informationFigure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in
9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade
More informationSupplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
More informationSupplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
More informationSupplementary Fig. 1. Aortic micrornas are differentially expressed in PFM v. GFM.
Reltive expression 5 1 15 2-5 5 (n = 3) (n = 3) GFM nd PFM PFM GFM mmu-mir-145 mmu-mir-143 mmu-mir-72 mmu-mir-22 mmu-mir-27 mmu-mir-125-5p mmu-mir-23 mmu-mir-29 mmu-mir-126-3p mmu-let-7d mmu-let-7c mmu-mir-199-3p
More informationSupplementary Information Titles
Supplementry Informtion Titles Journl: Nture Medicine Article Title: Corresponding Author: Modelling colorectl cncer using CRISPR-Cs9-medited engineering of humn intestinl orgnoids Toshiro Sto Supplementry
More informationTitle. CitationCancer science, 109(4): Issue Date Doc URL. Rights(URL)
Title Toll-like receptor 3 signal augments radiation-induc Yoshida, Sumito; Shime, Hiroaki; Takeda, Yohei; Nam, Author(s) Hiroki; Kasahara, Masanori; Seya, Tsukasa CitationCancer science, 19(): 956-965
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationTransduction of lentivirus to human primary CD4+ T cells
Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)
More informationSupplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
More informationKerdiles et al - Figure S1
Kerdiles et al - Figure S1 a b Homo sapiens T B ce ce l ls c l M ls ac r PM oph N ag es Mus musculus Foxo1 PLCγ Supplementary Figure 1 Foxo1 expression pattern is conserved between mouse and human. (a)
More informationSupporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationD14 D 10 D 7. Untreated CYTOXAN 5-FU
Dipeptidylpeptidse Negtively Regultes Colony Stimulting Fctor Activity nd Stress Hemtopoiesis. Hl E. Broxmeyer, Jonthn Hoggtt, Hether A. O Lery, Chrlie Mntel, Brhmnnd R. Chitteti, Scott Cooper, Steven
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril
More information