M-CSF from Cancer Cells Induces Fatty Acid Synthase and PPAR / Activation in Tumor Myeloid Cells, Leading to Tumor Progression

Transcription

1 Cell Reports Supplemental Information M-CSF from Cancer Cells Induces Fatty Acid Synthase and PPAR / Activation in Tumor Myeloid Cells, Leading to Tumor Progression Jonghanne Park, Sang Eun Lee, Jin Hur, Eun Byeol Hong, Jae-Il Choi, Ji-Min Yang, Ju- Young Kim, Young-Chan Kim, Hyun-Jai Cho, Jeffrey M. Peters, Seung-Bum Ryoo, Young Tae Kim, and Hyo-Soo Kim

2 A B C D E F G H Figure S1A-H. Expression of PPARβ/δ in human cancer tissue, related to Figure 1 IF staining of tumor tissue from human non-small cell lung cancer (A,E), colon adenocarcinoma (B,F) breast cancer (C,G) and papillary thyroid cancer (D,H). Upper panel (A-D) shows PECAM-1 (red) endothelial cells and PPARβ/δ (green). Lower panel (E-H) shows CD163/11b (red) myeloid cells and PPARβ/δ (green). Blue indicates nucleus.

3 I. Schematic illustration of the process Lung endothelial cells (LEC, Tie-2 GFP +) Tie-2 GFP mouse Lewis lung carcinoma Lung FACS GFP+ (Tie-2) for endothelial cells Lung myeloid cells (LMC, CD11b+) Tumor endothelial cells (TEC, Tie-2 GFP +) Tie-2 GFP mouse Tumor APC+ (CD11b) for myeloid cells Tumor myeloid cells (TMC, CD11b+) J. FACS of CD11b + myeloid cells and Tie-2 + endothelial cells from Lewis lung carcinoma and normal lung tissue. Tumor Lung 15.6 Tumor myeloid cells 15.1 Lung myeloid cells Tumor endothelial cells Lung endothelial cells CD11b 0.9 CD11b 11.2 Tie-2 GFP Tie-2 GFP Figure S1I-J. Process isolating endothelial cells and myeloid cells from Lewis lung carcinoma tumor tissue and from normal lung tissue, related to Figure 1. I. Schematic illustration of process isolating endothelial cells and myeloid cells from Lewis lung carcinoma (LLC) tumor tissue and from normal lung tissue. To compare PPARβ/δ expression and activation in tumor endothelial cells, tumor myeloid cells, normal endothelial cells, and normal myeloid cells, we isolated those cells from LLC tumor and from normal lung tissue using FACS sorting. LLC cells were injected into the left flank of Tie-2 GFP mice subcutaneously. Tie-2 GFP mice were used to facilitate isolation of endothelial cells. After 2 weeks, we harvested tumors from the tumor bearing mice and normal lung tissue from the normal mice to which we didn t inject cancer cells. We stained single cells from both tissue with anti-cd11b-apc antibodies and then, isolated Tie-2 GFP positive cells (endothelial cells) and CD11b positive cells (myeloid cells) using FACS. J. FACS of CD11b-APC positive myeloid cells and Tie-2 GFP positive endothelial cells from both LLC and normal lung tissue. Representative figures of two independent experiments. The numbers indicate percentage of each cell type in whole population

4 NOS2 Figure S2. Effect of PPARβ/δ deficiency on NOS2 expression in BMDM, related to Figure 3. NOS2 gene expression of myeloid cells treated with serum free media (SFM) or LLC cell conditioned media (LCM), n=4, n.s. not significant.

5 A B C CD11b IL-10 D E F Figure S3. CD11b high IL-10 - anti-tumoral myeloid cells and CD11b low IL-10 + protumoral myeloid cells in non-necrotic or necrotic area of tumors from PPARβ/δ wild-type or knockout bone marrow transplantation mice, related to Figure 4 A. CD11b (green) positive myeloid cells in non-necrotic area of the tumor tissue from PPARβ/δ wild-type (WT) bone marrow transplantation (BMT) mice. White arrow points CD11b high cells. Scale bars, 25μm. B. IL-10 (red) positive cells in non-necrotic area of the tumor tissue. Scale bars, 25μm C. Merged figure of A and B. Co-localization of CD11b low cells with IL-10 + cells. White arrow indicates CD11b high IL-10 - cells. Scale bars, 25μm D. H&E staining of necrotic area in tumors from PPARβ/δ knockout (KO) BMT mice. Scale bars, 50μm E. CD11b and IL-10 staining of necrotic area. Scale bars, 50μm F. CD11b high IL-10 - cells located in necrotic area.

6 A Figure S4A. IL-10 expression of tumor associated macrophages, related to Figure 4. LLC were implanted to wild-type C57 mice. After 2 week, the tumors were FACS analyzed to compare IL-10 expression between different macrophage populations. The red histogram depicts IL-10 expression in the whole CD11b(+)F4/80(+) Macrophages. Each panel shows IL-10 expression in the marker-positive macrophage population (black) compared to marker-negative population. N=6 in two independent experiments.

7 B C Figure SB-C. PPARβ/δ expression of CD11b lo CD206 pos cells and CD11b lo CD206 neg cells, related to Figure 4. IF staining of tumor tissue from LLC tumors of wild-type mice stained with CD11b (green) CD206 (red), PPARβ/δ (magenta) and DAPI (blue). A. CD11bloCD206pos cells in non-necrotic area of the tumor. B. CD11bloCD206pos cells in necrotic area of the tumor. Representative result of six tumors in two independent experiments.scale bars 25μm.

8 D WT KO CD206 CD206 F4/80 F4/80 Figure S4D. Effect of PPARβ/δ deficiency on M2-activated TAMs infiltration, related to Figure 4. LLC tumors from PPARβ/δ WT and KO BMT mice were FACS analyzed to quantify CD11b+F4/80+CD206+ M2-activated Macrophages. The histogram represents the percentage of CD11b+F4/80+CD206+ cells from total CD11b+ total myeloid cells, n=8 in each group from two independent experiment, * indicates p<0.05.

9 Figure S5. IL-10 levels in conditioned media from co-culture of LLC cells and PPARβ/δ KO or WT BMDMs as determined by ELISA, related to Figure 5. 24h and 48h indicates co-culture duration of 24 hours and 48 hours, respectively. MC indicates BMDMs. * indicates p<0.05 and ** indicates p<0.01. (n=2)

10 LCM FFA Myeloid cell culture in LCM FFA A. Conditioned media (LCM) Cancer cell Indomethacin pretreatment LCM PG LCM AA Conditioned media (LCM) Free fatty acids (FFAs) Prostaglandins (PGs) Arachidonic acids (AAs) Indomethacin Myeloid cell culture in LCM PG Myeloid cell culture in LCM AA LCM + Cerulenin FASN LCM + Indomethacin COX LCM + AACOCF3 Blocking exogenous factors Blocking endogenous factors PLA2 Myeloid cell Figure S6A. Schematic illustration of experimental protocol to test exogenous and endogenous factors regulating arginase I expression in myeloid cells. Effect of blocking free fatty acids (FFAs), arachidonic acids (AAs), prostaglandins (PGs) production in LLC and myeloid cells on arginase I expression in myeloid cells, related to Figure 6. To test exogenous ligands, we made fatty acids-, PGs-, or AAs-depleted LCM by treating FASN inhibitor, COX inhibitor or lipase inhibitor during LLC cell culture, respectively. After pretreatment of the inhibitor, culture plates were washed with PBS to remove inhibitors and then serum free media was added to obtain conditioned medium. L FFA indicates FFAs depleted LCM; L AA, AAs depleted LCM; L PG, PGs depleted LCM. To evaluate the endogenous ligands, fatty acids, PGs or AAs, we directly treated FASN inhibitor, COX inhibitor or lipase inhibitor to myeloid cells. L + cerulenin indicates LCM supplemented with cerulenin; L + AACOCF3, LCM supplemented with AACOCF3, L + Indomethacin, LCM supplemented with indomethacin.

11 B. FASN knockdown in LLC C. FASN knockdown in Raw Figure S6B-C. FASN knockdown by sh-fasn lentivirus transduction as determined by real-time PCR, related to Figure 6. B. FASN expression decreased in LLC cells by sh-fasn lentivirus transduction (n=3). C. FASN expression decreased in Raw264.7 myeloid cells by sh-fasn lentivirus transduction (n=3). sh-sc indicates sh-scramble lentivirus transducted cells and sh-fasn indicates sh-fasn transducted cells. * indicates p<0.05

12 A. Figure S7A. The role of myeloid PPARβ/δ for tumor growth in various cancer cell lines, related to Figure 7. Tumor weight in PPARβ/δ WT and KO BMT mice at 2 weeks after implantation. B16-F10, melanoma cell line; TrampC1, prostatic adenocarcinoma; 1C1C7, hepatoma; EO771, breast adenocarcinoma; CMT93, colon adenocarcinoma.

13 B. C. Figure S7B-C. Effect of conditioned medium from various cancer cell lines on myeloid cells, related to Figure 7. B. FASN expression in RAW myeloid cells with conditioned medium from various cancer cell lines (n=6). C. PPARβ/δ activation in myeloid cell determined by transactivation assay stimulated with conditioned medium from various cancer cell lines (n=5). B16-F10, melanoma cell line; TrampC1, pancreas adenocarcinoma; 1C1C7, hepatoma; EO771, breast adenocarcinoma; CMT93, colon adenocarcinoma.* indicates p<0.05.

14 Table S1. Primer sequence for realtime PCR, related to Figure 3. Gene mpparδ/β madrp margi mil-10 mtgf-β mfasn megf mmmp-9 mil-12p35 mvegf Primer sequence F - TGGAGCTCGATGACAGTGAC R - GTACTGGCTGTCAGGGTGGT F - AAGAGGCCAAACAAAAGAGCCAGGAGACCA R - ACCCTGAATTTTCTGGTTGGCACTGTGCAT F - AACACTCCCCTGACAACCAG R - GCAAGCCAATGTACACGATG F - CTGAGGCGCTGTCATCGATT R - AGGTCCTGGAGTCCAGCAGA F - TGACGTCACTGGAGTTGTAC R - GGTTCATGTCATGGATGGTG F - AGGTGGCAGAGGTGCTGGCT R - GCGCAGGGTCGGAAGGGTTC F - TCCGACACATGCATTTTGAT R - GATCAGTCTTTCTCGCTGGG F - CTGTCCAGACCAAGGGTACA R - GTGGTATAGTGGGACACATAGTGG F - AAATGAAGCTCTGCATCCTGC R - TCACCCTGTTGATGGTCACG F - CGGATCAAACCTCACCAAAG R - TTTCTCCGCTCTGAACAAGG Product length (bp) Primers for real-time qpcr (Tm = 60 C for all pairs). bp indicates base pair.

15 Supplemental Experimental Procedures, related to Experimental Procedures. Materials The 1C1C7 hepatoma cell line was obtained from Korean Cell line Bank. Lewis lung carcinoma and Tramp-C1 prostate cancer cell line were purchased from ATCC. CMT-93 was a kind gift of Dr. Ki-Baik Hahm, EO771 breast cancer cell line was a kind gift of Dr. Andreas Moller. (Sceneay et al., 2012; Sceneay et al., 2013) For staining of human cancer tissue, we obtained anonymized samples of fresh frozen tissue from the institute s cancer tissue bank. The study protocol was reviewed by Institutional Review Board of Seoul National University Hospital College of Medicine (IRB no ). IL-10 measurement in conditioned media of LLC cells co-cultured with BMDMs. For cytokine measurement of LLC cells co-cultured with BMDMs, PPARβ/δ WT or PPARβ/δ KO BMDMs were co-cultured with equal number of LLC cells on a 6-well plate for 12hr. After removal of growth media and washing with PBS, 1ml of SFM was added to collect the cytokines. After 24hr or 48hr, the supernatant was collected and centrifuged at 20,000g for 15min to remove cellular debris. The soluble proteins of supernatant were concentrated 10 times by centrifugal filter unit with the 3kDa cut-off (Millipore). The IL-10 concentration of each concentrated supernatant was measured with Bioplex cytokine assays (Bio-Rad Laboratories, Hercules, CA) according to the manufacturer's protocol. ChIP assay for PPARβ/δ binding on Arginase I promoter ChIP assay was performed according to the manufacturer s (Millipore) protocol with the following modifications. Briefly, BMDMs were grown on 10-cm plates with density of cells per plate. For each condition (SFM: control/lcm: stimulation), two plates were assigned. Each plate was incubated with SFM/LCM for 12hrs. Cells were then fixed by incubation in 1% formaldehyde for 10 min at room temperature. Cells scraped from the plates

16 underwent sonication using a Misonix Sonicator 3000 (Farmingdale), 6 C constant temperature for 10 30sec sonication cycles. These conditions were empirically established to give fragmentation of DNA with a mean length of bp. The lysate were incubated with polyclonal rabbit PPARβ/δ (Santacruz) antibody or isotype (IgG) control. Following overnight incubation at 4 C, salmon sperm-saturated protein A-agarose was added and incubated at 4 C with gentle rocking for 2hr. Immunoprecipitated material was washed and eluted. DNA crosslinks were reversed and resuspended in 50µl of 10 mm Tris, ph 8.0, 1 mm EDTA and subjected to PCR analysis for PPRE sequence of Arginase I as previously described (Odegaard et al., 2007). Positive control reactions were performed using the input samples to the immunoprecipitation reactions that had their cross-links reversed. The primer sequence for Arginase I promoter was Fwd 5 -AGCCGACGAGAGACCAGCTCA-3 and Rev 5 -GGAAGTCTGAACAATGCCTCACTTCCT-3. Real-time quantitative PCR Total RNA was extracted from indicated cells using RNeasy spin column (Qiagen) according to manufacturer s instruction. RT-PCR was performed as described previously(hur et al., 2004). cdna was synthesized using a Primescript 1st strand cdna synthesis kit (Takara) and oligo-dt primer. The quantification of gene transcripts was carried out by real-time PCR. Experiments were conducted to contrast relative levels of each transcript to endogenous control mgapdh or ml32. Real-time PCR was performed with Sybr Green I Mastermix (Roche), using an ABI PRISM TM 7500 Sequence Detection System (Applied Biosystems). The primer sequences are summarized in Table S1.

17 Supplemental References Hur, J., Yoon, C.H., Kim, H.S., Choi, J.H., Kang, H.J., Hwang, K.K., Oh, B.H., Lee, M.M., and Park, Y.B. (2004). Characterization of two types of endothelial progenitor cells and their different contributions to neovasculogenesis. Arterioscler Thromb Vasc Biol 24, Odegaard, J.I., Ricardo-Gonzalez, R.R., Goforth, M.H., Morel, C.R., Subramanian, V., Mukundan, L., Red Eagle, A., Vats, D., Brombacher, F., Ferrante, A.W., et al. (2007). Macrophage-specific PPARgamma controls alternative activation and improves insulin resistance. Nature 447, Sceneay, J., Chow, M.T., Chen, A., Halse, H.M., Wong, C.S., Andrews, D.M., Sloan, E.K., Parker, B.S., Bowtell, D.D., Smyth, M.J., et al. (2012). Primary tumor hypoxia recruits CD11b+/Ly6Cmed/Ly6G+ immune suppressor cells and compromises NK cell cytotoxicity in the premetastatic niche. Cancer Res 72, Sceneay, J., Liu, M.C., Chen, A., Wong, C.S., Bowtell, D.D., and Moller, A. (2013). The antioxidant N-acetylcysteine prevents HIF-1 stabilization under hypoxia in vitro but does not affect tumorigenesis in multiple breast cancer models in vivo. PloS one 8, e66388.