M-CSF from Cancer Cells Induces Fatty Acid Synthase and PPAR / Activation in Tumor Myeloid Cells, Leading to Tumor Progression
|
|
- Arthur Terry
- 5 years ago
- Views:
Transcription
1 Cell Reports Supplemental Information M-CSF from Cancer Cells Induces Fatty Acid Synthase and PPAR / Activation in Tumor Myeloid Cells, Leading to Tumor Progression Jonghanne Park, Sang Eun Lee, Jin Hur, Eun Byeol Hong, Jae-Il Choi, Ji-Min Yang, Ju- Young Kim, Young-Chan Kim, Hyun-Jai Cho, Jeffrey M. Peters, Seung-Bum Ryoo, Young Tae Kim, and Hyo-Soo Kim
2 A B C D E F G H Figure S1A-H. Expression of PPARβ/δ in human cancer tissue, related to Figure 1 IF staining of tumor tissue from human non-small cell lung cancer (A,E), colon adenocarcinoma (B,F) breast cancer (C,G) and papillary thyroid cancer (D,H). Upper panel (A-D) shows PECAM-1 (red) endothelial cells and PPARβ/δ (green). Lower panel (E-H) shows CD163/11b (red) myeloid cells and PPARβ/δ (green). Blue indicates nucleus.
3 I. Schematic illustration of the process Lung endothelial cells (LEC, Tie-2 GFP +) Tie-2 GFP mouse Lewis lung carcinoma Lung FACS GFP+ (Tie-2) for endothelial cells Lung myeloid cells (LMC, CD11b+) Tumor endothelial cells (TEC, Tie-2 GFP +) Tie-2 GFP mouse Tumor APC+ (CD11b) for myeloid cells Tumor myeloid cells (TMC, CD11b+) J. FACS of CD11b + myeloid cells and Tie-2 + endothelial cells from Lewis lung carcinoma and normal lung tissue. Tumor Lung 15.6 Tumor myeloid cells 15.1 Lung myeloid cells Tumor endothelial cells Lung endothelial cells CD11b 0.9 CD11b 11.2 Tie-2 GFP Tie-2 GFP Figure S1I-J. Process isolating endothelial cells and myeloid cells from Lewis lung carcinoma tumor tissue and from normal lung tissue, related to Figure 1. I. Schematic illustration of process isolating endothelial cells and myeloid cells from Lewis lung carcinoma (LLC) tumor tissue and from normal lung tissue. To compare PPARβ/δ expression and activation in tumor endothelial cells, tumor myeloid cells, normal endothelial cells, and normal myeloid cells, we isolated those cells from LLC tumor and from normal lung tissue using FACS sorting. LLC cells were injected into the left flank of Tie-2 GFP mice subcutaneously. Tie-2 GFP mice were used to facilitate isolation of endothelial cells. After 2 weeks, we harvested tumors from the tumor bearing mice and normal lung tissue from the normal mice to which we didn t inject cancer cells. We stained single cells from both tissue with anti-cd11b-apc antibodies and then, isolated Tie-2 GFP positive cells (endothelial cells) and CD11b positive cells (myeloid cells) using FACS. J. FACS of CD11b-APC positive myeloid cells and Tie-2 GFP positive endothelial cells from both LLC and normal lung tissue. Representative figures of two independent experiments. The numbers indicate percentage of each cell type in whole population
4 NOS2 Figure S2. Effect of PPARβ/δ deficiency on NOS2 expression in BMDM, related to Figure 3. NOS2 gene expression of myeloid cells treated with serum free media (SFM) or LLC cell conditioned media (LCM), n=4, n.s. not significant.
5 A B C CD11b IL-10 D E F Figure S3. CD11b high IL-10 - anti-tumoral myeloid cells and CD11b low IL-10 + protumoral myeloid cells in non-necrotic or necrotic area of tumors from PPARβ/δ wild-type or knockout bone marrow transplantation mice, related to Figure 4 A. CD11b (green) positive myeloid cells in non-necrotic area of the tumor tissue from PPARβ/δ wild-type (WT) bone marrow transplantation (BMT) mice. White arrow points CD11b high cells. Scale bars, 25μm. B. IL-10 (red) positive cells in non-necrotic area of the tumor tissue. Scale bars, 25μm C. Merged figure of A and B. Co-localization of CD11b low cells with IL-10 + cells. White arrow indicates CD11b high IL-10 - cells. Scale bars, 25μm D. H&E staining of necrotic area in tumors from PPARβ/δ knockout (KO) BMT mice. Scale bars, 50μm E. CD11b and IL-10 staining of necrotic area. Scale bars, 50μm F. CD11b high IL-10 - cells located in necrotic area.
6 A Figure S4A. IL-10 expression of tumor associated macrophages, related to Figure 4. LLC were implanted to wild-type C57 mice. After 2 week, the tumors were FACS analyzed to compare IL-10 expression between different macrophage populations. The red histogram depicts IL-10 expression in the whole CD11b(+)F4/80(+) Macrophages. Each panel shows IL-10 expression in the marker-positive macrophage population (black) compared to marker-negative population. N=6 in two independent experiments.
7 B C Figure SB-C. PPARβ/δ expression of CD11b lo CD206 pos cells and CD11b lo CD206 neg cells, related to Figure 4. IF staining of tumor tissue from LLC tumors of wild-type mice stained with CD11b (green) CD206 (red), PPARβ/δ (magenta) and DAPI (blue). A. CD11bloCD206pos cells in non-necrotic area of the tumor. B. CD11bloCD206pos cells in necrotic area of the tumor. Representative result of six tumors in two independent experiments.scale bars 25μm.
8 D WT KO CD206 CD206 F4/80 F4/80 Figure S4D. Effect of PPARβ/δ deficiency on M2-activated TAMs infiltration, related to Figure 4. LLC tumors from PPARβ/δ WT and KO BMT mice were FACS analyzed to quantify CD11b+F4/80+CD206+ M2-activated Macrophages. The histogram represents the percentage of CD11b+F4/80+CD206+ cells from total CD11b+ total myeloid cells, n=8 in each group from two independent experiment, * indicates p<0.05.
9 Figure S5. IL-10 levels in conditioned media from co-culture of LLC cells and PPARβ/δ KO or WT BMDMs as determined by ELISA, related to Figure 5. 24h and 48h indicates co-culture duration of 24 hours and 48 hours, respectively. MC indicates BMDMs. * indicates p<0.05 and ** indicates p<0.01. (n=2)
10 LCM FFA Myeloid cell culture in LCM FFA A. Conditioned media (LCM) Cancer cell Indomethacin pretreatment LCM PG LCM AA Conditioned media (LCM) Free fatty acids (FFAs) Prostaglandins (PGs) Arachidonic acids (AAs) Indomethacin Myeloid cell culture in LCM PG Myeloid cell culture in LCM AA LCM + Cerulenin FASN LCM + Indomethacin COX LCM + AACOCF3 Blocking exogenous factors Blocking endogenous factors PLA2 Myeloid cell Figure S6A. Schematic illustration of experimental protocol to test exogenous and endogenous factors regulating arginase I expression in myeloid cells. Effect of blocking free fatty acids (FFAs), arachidonic acids (AAs), prostaglandins (PGs) production in LLC and myeloid cells on arginase I expression in myeloid cells, related to Figure 6. To test exogenous ligands, we made fatty acids-, PGs-, or AAs-depleted LCM by treating FASN inhibitor, COX inhibitor or lipase inhibitor during LLC cell culture, respectively. After pretreatment of the inhibitor, culture plates were washed with PBS to remove inhibitors and then serum free media was added to obtain conditioned medium. L FFA indicates FFAs depleted LCM; L AA, AAs depleted LCM; L PG, PGs depleted LCM. To evaluate the endogenous ligands, fatty acids, PGs or AAs, we directly treated FASN inhibitor, COX inhibitor or lipase inhibitor to myeloid cells. L + cerulenin indicates LCM supplemented with cerulenin; L + AACOCF3, LCM supplemented with AACOCF3, L + Indomethacin, LCM supplemented with indomethacin.
11 B. FASN knockdown in LLC C. FASN knockdown in Raw Figure S6B-C. FASN knockdown by sh-fasn lentivirus transduction as determined by real-time PCR, related to Figure 6. B. FASN expression decreased in LLC cells by sh-fasn lentivirus transduction (n=3). C. FASN expression decreased in Raw264.7 myeloid cells by sh-fasn lentivirus transduction (n=3). sh-sc indicates sh-scramble lentivirus transducted cells and sh-fasn indicates sh-fasn transducted cells. * indicates p<0.05
12 A. Figure S7A. The role of myeloid PPARβ/δ for tumor growth in various cancer cell lines, related to Figure 7. Tumor weight in PPARβ/δ WT and KO BMT mice at 2 weeks after implantation. B16-F10, melanoma cell line; TrampC1, prostatic adenocarcinoma; 1C1C7, hepatoma; EO771, breast adenocarcinoma; CMT93, colon adenocarcinoma.
13 B. C. Figure S7B-C. Effect of conditioned medium from various cancer cell lines on myeloid cells, related to Figure 7. B. FASN expression in RAW myeloid cells with conditioned medium from various cancer cell lines (n=6). C. PPARβ/δ activation in myeloid cell determined by transactivation assay stimulated with conditioned medium from various cancer cell lines (n=5). B16-F10, melanoma cell line; TrampC1, pancreas adenocarcinoma; 1C1C7, hepatoma; EO771, breast adenocarcinoma; CMT93, colon adenocarcinoma.* indicates p<0.05.
14 Table S1. Primer sequence for realtime PCR, related to Figure 3. Gene mpparδ/β madrp margi mil-10 mtgf-β mfasn megf mmmp-9 mil-12p35 mvegf Primer sequence F - TGGAGCTCGATGACAGTGAC R - GTACTGGCTGTCAGGGTGGT F - AAGAGGCCAAACAAAAGAGCCAGGAGACCA R - ACCCTGAATTTTCTGGTTGGCACTGTGCAT F - AACACTCCCCTGACAACCAG R - GCAAGCCAATGTACACGATG F - CTGAGGCGCTGTCATCGATT R - AGGTCCTGGAGTCCAGCAGA F - TGACGTCACTGGAGTTGTAC R - GGTTCATGTCATGGATGGTG F - AGGTGGCAGAGGTGCTGGCT R - GCGCAGGGTCGGAAGGGTTC F - TCCGACACATGCATTTTGAT R - GATCAGTCTTTCTCGCTGGG F - CTGTCCAGACCAAGGGTACA R - GTGGTATAGTGGGACACATAGTGG F - AAATGAAGCTCTGCATCCTGC R - TCACCCTGTTGATGGTCACG F - CGGATCAAACCTCACCAAAG R - TTTCTCCGCTCTGAACAAGG Product length (bp) Primers for real-time qpcr (Tm = 60 C for all pairs). bp indicates base pair.
15 Supplemental Experimental Procedures, related to Experimental Procedures. Materials The 1C1C7 hepatoma cell line was obtained from Korean Cell line Bank. Lewis lung carcinoma and Tramp-C1 prostate cancer cell line were purchased from ATCC. CMT-93 was a kind gift of Dr. Ki-Baik Hahm, EO771 breast cancer cell line was a kind gift of Dr. Andreas Moller. (Sceneay et al., 2012; Sceneay et al., 2013) For staining of human cancer tissue, we obtained anonymized samples of fresh frozen tissue from the institute s cancer tissue bank. The study protocol was reviewed by Institutional Review Board of Seoul National University Hospital College of Medicine (IRB no ). IL-10 measurement in conditioned media of LLC cells co-cultured with BMDMs. For cytokine measurement of LLC cells co-cultured with BMDMs, PPARβ/δ WT or PPARβ/δ KO BMDMs were co-cultured with equal number of LLC cells on a 6-well plate for 12hr. After removal of growth media and washing with PBS, 1ml of SFM was added to collect the cytokines. After 24hr or 48hr, the supernatant was collected and centrifuged at 20,000g for 15min to remove cellular debris. The soluble proteins of supernatant were concentrated 10 times by centrifugal filter unit with the 3kDa cut-off (Millipore). The IL-10 concentration of each concentrated supernatant was measured with Bioplex cytokine assays (Bio-Rad Laboratories, Hercules, CA) according to the manufacturer's protocol. ChIP assay for PPARβ/δ binding on Arginase I promoter ChIP assay was performed according to the manufacturer s (Millipore) protocol with the following modifications. Briefly, BMDMs were grown on 10-cm plates with density of cells per plate. For each condition (SFM: control/lcm: stimulation), two plates were assigned. Each plate was incubated with SFM/LCM for 12hrs. Cells were then fixed by incubation in 1% formaldehyde for 10 min at room temperature. Cells scraped from the plates
16 underwent sonication using a Misonix Sonicator 3000 (Farmingdale), 6 C constant temperature for 10 30sec sonication cycles. These conditions were empirically established to give fragmentation of DNA with a mean length of bp. The lysate were incubated with polyclonal rabbit PPARβ/δ (Santacruz) antibody or isotype (IgG) control. Following overnight incubation at 4 C, salmon sperm-saturated protein A-agarose was added and incubated at 4 C with gentle rocking for 2hr. Immunoprecipitated material was washed and eluted. DNA crosslinks were reversed and resuspended in 50µl of 10 mm Tris, ph 8.0, 1 mm EDTA and subjected to PCR analysis for PPRE sequence of Arginase I as previously described (Odegaard et al., 2007). Positive control reactions were performed using the input samples to the immunoprecipitation reactions that had their cross-links reversed. The primer sequence for Arginase I promoter was Fwd 5 -AGCCGACGAGAGACCAGCTCA-3 and Rev 5 -GGAAGTCTGAACAATGCCTCACTTCCT-3. Real-time quantitative PCR Total RNA was extracted from indicated cells using RNeasy spin column (Qiagen) according to manufacturer s instruction. RT-PCR was performed as described previously(hur et al., 2004). cdna was synthesized using a Primescript 1st strand cdna synthesis kit (Takara) and oligo-dt primer. The quantification of gene transcripts was carried out by real-time PCR. Experiments were conducted to contrast relative levels of each transcript to endogenous control mgapdh or ml32. Real-time PCR was performed with Sybr Green I Mastermix (Roche), using an ABI PRISM TM 7500 Sequence Detection System (Applied Biosystems). The primer sequences are summarized in Table S1.
17 Supplemental References Hur, J., Yoon, C.H., Kim, H.S., Choi, J.H., Kang, H.J., Hwang, K.K., Oh, B.H., Lee, M.M., and Park, Y.B. (2004). Characterization of two types of endothelial progenitor cells and their different contributions to neovasculogenesis. Arterioscler Thromb Vasc Biol 24, Odegaard, J.I., Ricardo-Gonzalez, R.R., Goforth, M.H., Morel, C.R., Subramanian, V., Mukundan, L., Red Eagle, A., Vats, D., Brombacher, F., Ferrante, A.W., et al. (2007). Macrophage-specific PPARgamma controls alternative activation and improves insulin resistance. Nature 447, Sceneay, J., Chow, M.T., Chen, A., Halse, H.M., Wong, C.S., Andrews, D.M., Sloan, E.K., Parker, B.S., Bowtell, D.D., Smyth, M.J., et al. (2012). Primary tumor hypoxia recruits CD11b+/Ly6Cmed/Ly6G+ immune suppressor cells and compromises NK cell cytotoxicity in the premetastatic niche. Cancer Res 72, Sceneay, J., Liu, M.C., Chen, A., Wong, C.S., Bowtell, D.D., and Moller, A. (2013). The antioxidant N-acetylcysteine prevents HIF-1 stabilization under hypoxia in vitro but does not affect tumorigenesis in multiple breast cancer models in vivo. PloS one 8, e66388.
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationThe toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells
1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationCombined Rho-kinase inhibition and immunogenic cell death triggers and propagates immunity against cancer
Supplementary Information Combined Rho-kinase inhibition and immunogenic cell death triggers and propagates immunity against cancer Gi-Hoon Nam, Eun-Jung Lee, Yoon Kyoung Kim, Yeonsun Hong, Yoonjeong Choi,
More informationNature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationSupporting Information
Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,
More informationAntibodies: LB1 buffer For 50 ml For 10ml For 30 ml Final 1 M HEPES, ph 2.5 ml 0.5 ml 1.5 ml 50mM. 5 M NaCl 1.4 ml 280 µl 0.
Experiment: Date: Tissue: Purpose: ChIP-Seq Antibodies: 11x cross-link buffer: Regent Stock Solution Final Vol for 10 ml of 11xstock concentration 5 M NaCl 0.1M 0.2 ml 0.5 M EDTA 1 mm 20 ul 0.5 M EGTA,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationSupplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationSupplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
More informationBlocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
More informationSupplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
More informationMacrophages form functional vascular mimicry channels in vivo. SI Figures and Legend
Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin
More informationPeli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
More informationTargeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationB16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/352/352ra110/dc1 Supplementary Materials for Spatially selective depletion of tumor-associated regulatory T cells with near-infrared photoimmunotherapy
More informationSupplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationSupplemental Experimental Procedures
Cell Stem Cell, Volume 2 Supplemental Data A Temporal Switch from Notch to Wnt Signaling in Muscle Stem Cells Is Necessary for Normal Adult Myogenesis Andrew S. Brack, Irina M. Conboy, Michael J. Conboy,
More informationFile Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationSupplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained
Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21
More informationSupplementary Materials for
immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
More informationBMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented
Supplemental Materials Figure S1. Cultured BMDCs express CD11c BMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented with 15 ng/ml GM-CSF. Media was changed and fresh
More informationDipeptidyl Peptidase-4 Inhibitor Increases Vascular Leakage in Retina through VE-cadherin. Phosphorylation
Dipeptidyl Peptidase-4 Inhibitor Increases Vascular Leakage in Retina through VE-cadherin Phosphorylation Choon-Soo Lee, PhD, 1,2,4 * Yun Gi Kim, MD, 3 * Hyun-Jai Cho, MD, 1,2,3 Jonghanne Park, MD, 1,2,3
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationSupplemental Material
Supplemental Material Supplementary Fig. 1. EETs stimulate primary tumor growth. a) Schematic presentation of genetic and pharmacological tools used to manipulate endogenous EET levels. b) Endothelial
More informationS1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
More informationProduct Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4
INSTRUCTION MANUAL Quick-RNA Midiprep Kit Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
More informationEndocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
More informationChromatin Immunoprecipitation (ChIPs) Protocol (Mirmira Lab)
Chromatin Immunoprecipitation (ChIPs) Protocol (Mirmira Lab) Updated 12/3/02 Reagents: ChIP sonication Buffer (1% Triton X-100, 0.1% Deoxycholate, 50 mm Tris 8.1, 150 mm NaCl, 5 mm EDTA): 10 ml 10 % Triton
More informationFigure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h
Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)
More informationGraveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document
Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley
More informationsequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
More informationSupplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
More informationSupplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More informationHeat-killed Lactobacillus casei
Heat-killed Lactobacillus casei confers broad protection against influenza A virus primary infection and develops heterosubtypic immunity against future secondary infection Yu-Jin Jung, Young-Tae Lee,
More informationSupplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
More informationEpithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive
Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationL1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
More informationPBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human
Anti-CD19-CAR transduced T-cell preparation PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human AB serum (Gemini) and 300 international units/ml IL-2 (Novartis). T cell proliferation
More informationSupplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
More informationSHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
More informationDepartment of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2
Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji
More informationSupplemental Information. Angiocrine Factors Deployed by Tumor Vascular. Niche Induce B Cell Lymphoma Invasiveness. and Chemoresistance
Cancer Cell, Volume 25 Supplemental Information Angiocrine Factors Deployed by Tumor Vascular Niche Induce B Cell Lymphoma Invasiveness and Chemoresistance Zhongwei Cao, Bi-Sen Ding, Peipei Guo, Sharrell
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationOnline Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2
Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of
More informationECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
More informationExpression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
More informationFigure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a
Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationSupporting Information
Supporting Information Shime et al. 1.173/pnas.11139919 SI Methods Reagents. was purchased from GE Healthcare, which was free from LPS contamination. TNF-α and IFN-β ELISA kit was purchased from eioscience
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationF-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
More informationSUPPORTING MATREALS. Methods and Materials
SUPPORTING MATREALS Methods and Materials Cell Culture MC3T3-E1 (subclone 4) cells were maintained in -MEM with 10% FBS, 1% Pen/Strep at 37ºC in a humidified incubator with 5% CO2. MC3T3 cell differentiation
More informationGraveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document
Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley
More informationPrimer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A
Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG
More informationFigure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
More informationSupporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationTitle of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationSupplementary figure 1. Systemic delivery of anti-cd47 antibody controls tumor growth in
T u m o r v o lu m e (m m 3 ) P e rc e n t s u rv iv a l P e rc e n t s u rv iv a l Supplementary data a 1 8 6 4 2 5 1 1 5 2 2 5 3 3 5 4 T im e a fte r tu m o r in o c u la tio n (d ) b c 1 5 1 1 5 * *
More informationCD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer
CD14 + S1A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer Po-Hao, Feng M.D., Kang-Yun, Lee, M.D. Ph.D., Ya-Ling Chang, Yao-Fei Chan, Lu- Wei, Kuo,Ting-Yu
More information