Key words: DL-methionine, growth performance, L-methionine, muscle gene expression, pig, plasma amino acid and metabolite
|
|
- Mavis Hilary Norris
- 5 years ago
- Views:
Transcription
1 Effects of dietry supplementtion of l-methionine vs. dl-methionine on performnce, plsm concentrtions of free mino cids nd other metolites, nd myogenesis gene expression in young growing pigs Zhongyue Yng,* Md. Shmimul Hsn,* John K. Htoo, Derris D. Burnett,* Jen M. Feugng,*, Mrk A. Crenshw,* nd Shengf F. Lio*,1, *Deprtment of Animl nd Diry Sciences, Mississippi Stte University, Strkville, MS ; nd Evonik Nutrition & Cre GmH, Hnu-Wolfgng, Germny ABSTRACT: Methionine (Met), the second or third limiting mino cid (AA) in typicl swine diets, plys importnt roles in promoting swine helth nd growth, especilly, muscle growth. Wheres dl- Met products hve een used in swine industry for mny yers, l-met products hve een developed recently. This reserch ws conducted to study the effects of supplementl l-met or dl-met on nutrient metolism, muscle gene expression, nd growth performnce of pigs. Twenty crossred young rrows (initil ody weight [BW] 21.2 ± 2.7 kg) were rndomly ssigned to 20 individul pens nd two dietry tretments ccording to completely rndomized design with pigs serving s the experiment unit (n = 10). Two corn nd soyen mel-sed diets (diets 1 nd 2) were formulted to meet or exceed the recommended requirements for energy, AA, nd other nutrients (NRC Nutrient requirements of swine, 11th ed. Wshington, DC: The Ntionl Acdemies Press; AMINODt 5.0). Crystlline l- Met nd dl-met were supplemented to diets 1 nd 2 (oth t 0.13%, s-fed sis), respectively. After 4 wk of n d liitum feeding tril, BW nd feed intke were mesured to clculte verge dily gin (ADG), verge dily feed intke (ADFI), nd ginto-feed rtio (G:F). Blood smples were collected from the jugulr vein for nlyses of plsm AA nd metolite concentrtions. The longissimus dorsi muscle smples were collected for nlysis of myogenesis gene expression. Dt were nlyzed using Student s t-test. There were no differences (P = 0.56 to 0.94) in ADG, ADFI, or G:F etween pigs fed the two experimentl diets nd no differences etween diets were oserved in plsm free AA concentrtions. No differences were oserved etween pigs fed the two diets in expression of mrna for eight myogenesis-relted genes, which were myogenic differentition 1, myogenin, myogenic fctors 5, muscle regultory fctor 4 (.k.. myogenic fctors 6), nd myocyte enhncer fctors 2A, 2B, 2C, nd 2D. In conclusion, results of this experiment indicte tht the ioefficcy of l-met is not different from tht of dl-met, which is likely ecuse of n efficient conversion of d-met to l-met y pigs. Key words: DL-methionine, growth performnce, L-methionine, muscle gene expression, pig, plsm mino cid nd metolite The Author(s) Pulished y Oxford University Press on ehlf of the Americn Society of Animl Science. This is n Open Access rticle distriuted under the terms of the Cretive Commons Attriution Non-Commercil License ( which permits non-commercil re-use, distriution, nd reproduction in ny medium, provided the originl work is properly cited. For commercil re-use, plese contct journls.permissions@oup.com Trnsl. Anim. Sci : doi: /ts/txy109 1 Corresponding uthor: s.lio@msstte.edu Received June 29, Accepted Septemer 24, INTRODUCTION The primry tissue component of pork is skeletl muscle nd, thus, knowledge concerning the
2 114 Yng et l. growth nd development of muscle in pigs is crucil for the industry from either n economic or technicl stndpoint (Lio et l., 2015). Proteins, the mjor chemicl component of muscle, re synthesized from mino cids (AA), which originte from dietry proteins including supplemented crystlline AA (O Connor et l., 2003; Li et l., 2016). Among the 20 proteinogenic AA in nture, 10 re dietrily indispensle ecuse pigs cnnot de novo synthesize them or cnnot synthesize enough to meet their metolic requirements (NRC, 2012). Methionine (Met) is typiclly the second or third limiting indispensle AA in grin-sed swine diets. In ddition to serving s uilding lock for protein synthesis, Met plys importnt roles in exerting numerous metolic nd physiologicl functions in pigs, including functioning s mjor methyl donor, s n importnt source of sulfur, s n endogenous ntioxidnt, nd s precursors of mny ioctive compounds (Zhi et l., 2012; Shen et l., 2014). Dietry supplementtion of Met cn increse nitrogen (N) retention nd muscle protein ccretion in pigs vi incresing protein synthesis nd decresing protein degrdtion nd, thus, improve growth performnce (Chung nd Bker, 1992; Zimmermnn et l., 2005; Kim et l., 2006; Wen et l., 2014; Kong et l., 2016, 2016). Dietry supplementtion of Met hs een prcticed for mny yers in the swine industry. Feedgrde crystlline dl-met hs een conventionl form of commercil Met products, which consists of 50% d-met nd 50% l-met. Recently, nother form of feed-grde Met, l-met, hs ecome ville on the mrket. The l-met products re produced either from chemicl synthesis or from fermenttion of plnt-sed rw mterils (Willke, 2014). Reserch hs een conducted to investigte the nutritionl vlue of l-met in pigs (Shen et l., 2014; Kong et l., 2016, 2016; Tin et l., 2016), ut severl spects of the mechnism y which l-met ffects muscle growth hve not een elucidted. This study ws conducted to investigte the effects of l-met vs. dl- Met on growth performnce, plsm concentrtions of 22 free AAs nd six representtive metolites, s well s the expression of eight genes relted to myogenesis in growing pigs. The overll hypothesis of this study ws tht the nutritionl ioefficcy of l-met is higher thn tht of dl-met, which would e reflected in the prmeters mesured in the study. MATERIALS AND METHODS All experimentl procedures involving cring, hndling, nd tretment of pigs were pproved y the Mississippi Stte University Institutionl Animl Cre nd Use Committee. Animl Feeding Tril A totl of 20 crossred (Lrge White Lndrce) young growing rrows (round 5 wk of ge) were purchsed from locl commercil frm nd trnsferred to n environmentlly controlled swine rn t the Leveck Animl Reserch Center of Mississippi Stte University. After rrivl, pigs were ssigned into five feeding pens nd fed commercil nursery diet until their ody weight (BW) reched 21.2 ± 2.7 kg, during which period pigs were llowed d liitum ccess to the diet nd wter. Pigs were then rndomly ssigned to 20 individul pens, nd llotted to two dietry tretments ccording to completely rndomized experimentl design with pigs serving s the experimentl unit. On the sis of nlyzed AA contents in the mjor feed ingredients used, two corn nd soyen mel-sed diets (diets 1 nd 2) were formulted to meet the NRC (2012) requirements for energy, crude protein (CP), minerls, nd vitmins. For indispensle AA, the requirement stndrds of AMINODt 5.0 (Pltinum Version, Evonik Nutrition & Cre GmH, Hnu-Wolfgng, Germny) were followed. Crystlline l-met nd dl-met were supplemented to diets 1 nd 2 (oth t 0.13%, s-fed sis), respectively, to meet pigs requirement for Met (Tle 1). Supplementl dl- Met (MetAMINO) nd l-met products were otined from Evonik Nutrition & Cre GmH. To confirm the contents of mjor nutrients, representtive smples of the two diets were sumitted to the Essig Animl Nutrition Lortory t Mississippi Stte University for energy nd proximte nlyses, nd to n Evonik s lortory in Hnu-Wolfgng, Germny for AA nlysis. The nlyzed composition of selected nutrients contined in the two diets is shown in Tle 2. During the 4-wk feeding tril, pigs were llowed d liitum ccess to experimentl diets, nd wter ws ville t ll times. All feeders nd wterers were checked t lest three times dily (0600 to 2200 h) to ensure proper function of the fcilities nd norml ehvior of nimls. Orts nd refusl feed were collected nd returned to the feeders immeditely or reserved nd weighed for feed intke clcultion. Individul pig BW were recorded t the eginning nd the end of the 4-wk experiment. Dily feed llotments were recorded s well, nd t the conclusion of the experiment, dt were summrized to clculte verge dily gin (ADG),
3 Effects of L- vs. DL-methionine in pigs 115 Tle 1. Composition of the experimentl diets fed to the growing pigs (s-fed sis) Dietry tretment Item Diet 1 Diet 2 Ingredient, % Corn Soyen mel Poultry ft l-lysine HCl, 78.8% Methionine, 99% l-threonine, 98.5% l-tryptophn, 98% l-isoleucine, 96% l-vline, 96.5% l-cysteine HCl, 99.7% Limestone Diclcium phosphte Slt Minerl premix c Vitmin premix c Totl Mjor nutrients, clculted d Dry mtter, % Net energy (kcl/kg) 2,440 2,440 Crude ft Crude fier Ash SID CP, % SID lysine, % SID methionine, % SID methionine + cysteine, % SID threonine, % SID tryptophn, % SID vline, % SID isoleucine, % Totl clcium, % STTD phosphorus, % Crude fier, % Ash, % l-lysine HCl (contining 78.8% l-lysine) nd l-threonine were purchsed from Archer Dniels Midlnd Co (Quincy, IL). l-tryptophn nd l-vline were donted from Ajinomoto Hertlnd, Inc (Chicgo, IL). l-cysteine HCl (contining 76.9% l-cysteine) ws purchsed from Wuhn Grnd Hoyo Co, Ltd (Wuhn, Huei, Chin). L-methionine nd dl-methionine (MetAMINO) were otined from Evonik Nutrition & Cre GmH (Hnu-Wolfgng, Germny) nd used in diets 1 nd 2, respectively. c Minerl premix (No. NB-8534) nd vitmin premix (No. NB-6508A) were donted from Nutr Blend, LLC (Neosho, MO). The clculted minerl nd vitmin contents in oth diets were (per kg of diet): N, 1.0 g; Cl, 2.8 g; K, 6.1 g; Mg, 1.4 g; S, 1.5 g; Cu, 16.7 mg; Fe, mg; I, 0.20 mg; Mn, 37.9 mg; Zn, mg, Se, 0.28 mg; vitmin A, 3,081 IU; vitmin D 3, 385 IU; vitmin E, 29.5 IU; vitmin K, 1.23 mg; vitmin B 1, 2.29 mg; vitmin B 2, 3.65 mg; nicin, 36.2 mg; vitmin B 5, 13.3 mg; vitmin B 6, 5.02 mg; iotin, 0.10 mg; folcin, 0.39 mg; vitmin B 12, 10.8 µg, nd choline, 1.39 mg. d SID = stndrdized ilel digestile. STTD = stndrdized totl trct digestile. Tle 2. The nlyzed nutrient composition (%, or s indicted) of the two experimentl diets fed to the growing pigs (s-fed sis) verge dily feed intke (ADFI), nd gin-to-feed rtio (G:F) for ech pen nd ech tretment group. Smple Collection nd Anlyses Dietry tretment Nutrient nd energy Diet 1 Diet 2 Proximte nlysis Dry mtter Gross energy, kcl/kg 3,969 3,944 CP Crude ft Crude fier Ash Dietry totl AA Lysine Methionine Cysteine Methionine + cysteine Threonine Tryptophn Arginine Histidine Leucine Isoleucine Vline Phenyllnine Proline Asprtic cid Glutmic cid Serine Alnine Glycine Dietry free AA Lysine Methionine Threonine Vline Isoleucine Diet 1 = l-methionine supplemented diet; diet 2 = dl-methionine supplemented diet. Proximte nd energy nlyses were conducted t the Essig Animl Nutrition Lortory, Mississippi Stte University (Strkville, MS). AA nlysis ws conducted t the nlyticl lortory of Evonik Nutrition & Cre GmH (Hnu-Wolfgng, Germny). At the eginning nd lso t the end of the 4-wk experiment, lood smples were collected vi jugulr venipuncture (pproximtely 10 ml/ pig) in erly morning (etween 0600 nd 0800 h). Immeditely efore leeding, feed in ll feeders ws removed. Collected lood smples were plced on
4 116 Yng et l. ice until plsm ws seprted within 30 min y centrifugtion of the smples t 800 g nd 4 C for 16 min. Blood plsm smples in 500-µL liquots were then stored t 80 C until lortory nlyses of nutrient metolites nd free AA. After lood collection, muscle smple (out 200 mg) ws collected from the middle portion of longissimus dorsi muscle of ech pig using our stndrd septic iopsy protocol (Burnett et l., 2016). All muscle smples collected were snp frozen in liquid N, nd then trnsferred to 80 C freezer for storge until nlyses. For determintion of plsm metolites, tch nlysis ws performed using the utomted ACE Aler Clinicl Chemistry System (Alf Wssermnn, West Cldwell, NJ) with six respective ACE regents (Alf Wssermnn) for glucose, totl protein, lumin, ure N, totl cholesterol, nd totl triglycerides. Determintion of these metolites involved enzymtic rections with pproprite enzymes, followed y ichromtic mesurements of respective rection products t different wvelengths to determine the concentrtions. Briefly, the glucose ssy ws conducted using the hexokinse method (Todd et l., 1979). Ure N concentrtion ws determined using the Urese-GLDH method (Tietz et l., 1995). The cholesterol ssy ws conducted using hydrolysis method involving cholesterol esterse, cholesterol oxidse, nd peroxidse (Artiss nd Zk, 1997). The triglyceride ssy ws lso conducted with n enzymtic method involving lipse, glycerol kinse, glycerol phosphte oxidse, nd peroxidse (Kli nd Pundir, 2004). The ssy of lumin concentrtion involved specific inding etween romocresol green nd lumin (Tietz et l., 1995). Likewise, the ssy of totl protein involved rection of cupric ions with peptide onds under lkline conditions (Tietz et l., 1995). The concentrtions of plsm free AA were determined using high-performnce liquid chromtogrphy (HPLC) methods (Lio et l., 2005; Wu nd Meininger, 2008; Di et l. 2014). Briefly, fter pre-column derivtiztion of plsm AA with o-phthldildehyde, smples were seprted on Supelco 3-μm reversed-phse C18 column ( mm, i.d.) gurded y Supelco 40-μm reversed-phse C18 column ( mm, i.d.). The HPLC moile phse consisted of solvent A (0.1 M sodium cette/0.5% tetrhydrofurn/9% methnol; ph 7.2) nd solvent B (methnol), with comined totl flow rte of 1.1 ml/min. A grdient progrm with totl running time of 49 min ws developed for stisfctory seprtion of AA. Gene Expression Anlyses Totl RNA ws extrcted from pproximtely 50 mg of muscle smple per niml using TRIzol Regent (Invitrogen Corportion, Crlsd, CA) ccording to the mnufcturer s instructions. Briefly, frozen tissue ws homogenized in 15-mL polypropylene centrifuge tue using Polytron mixer (0.5 ml TRIzol per 50 mg tissue), nd the homogente trnsferred to 1.5-mL micro-centrifuge tue. Chloroform (400 μl/tue) ws used to seprte RNA from DNA nd proteins, nd then the totl RNA ws precipitted with isopropyl lcohol (t 1:1 rtio) nd wshed with 750 μl of 75% ethnol. The resulted RNA ws ir-dried, dissolved in 60 μl RNse-free wter, nd stored t 80 C in freezer. The purity nd concentrtion of the RNA smples were mesured using n ND-1000 spectrophotometer (NnoDrop Technologies, Wilmington, DE). First-strnd cdna were reverse-trnscried from 1 µg of totl RNA y using QuntiTect Reverse Trnscription Kit (Qigen, Vlenci, CA). The semi-quntittive polymerse chin rection (PCR) nlysis ws performed with the Rotor- Gene SYBR Green PCR Kit using the Rotor-Gene Q System (Qigen), followed y melting curve nlysis to verify the specificity nd identity of the PCR products. The therml cycling prmeters were 95 C for 5 min, followed y 40 cycles of 95 C for 5 s nd 60 C for 10 s. Primers for the selected genes were designed y using PrimerQuest Tool (Integrted DNA Technologies, Corlville, IA). The sequences of the designed primers nd the relevnt informtion ssocited with these primers re shown in Tle 3. Also shown in Tle 3 is the endogenous control gene, Hprft1 (hypoxnthine phosphoriosyl trnsferse 1), used for normliztion of ny vrition during the smple preprtion (Nygrd et l., 2007). The comprtive ΔΔC T method ws used for mrna quntity clcultion. Briefly, the rw quntity of given gene ws normlized ginst the rw quntity of Hprft1 reference gene of given smple otined from the Rotor-Gene Q System, nd then the normlized level of the given gene of ech smple ws expressed s quntity reltive to the men of the normlized quntities of the given gene of the diet 2 smples. Sttisticl Anlysis Dt were sujected to sttisticl nlysis with Student s t-test y using the SAS softwre (version
5 Effects of L- vs. DL-methionine in pigs 117 Tle 3. Rel-time PCR primers for the selected genes Gene nme Gene symol RefSeq ID Primer sequence Amplicon size (p) Myogenic differentition 1 MYOD1 NM_ CCTAAAGCCCGAGGAACACT 152 TAGTGGTCTTGCGTTTGCAC Myogenin MYOG NM_ GACGAGTTTGAGCCACGAGT 148 ATTTCCTCTTGCACGCTTTG Myogenic fctor 5 MYF5 NM_ AGTGCCCCTGGAAGATAAGG 160 GGCCTCATTCACCTTCTTGA Myogenic regultory fctor 4 MRF4 NM_ ACAAAATGCAGGAGCTAGGC CTCCTTCCTTGGCAGTCATC 150 Myocyte enhncer fctor 2A Myocyte enhncer fctor 2B Myocyte enhncer fctor 2C Myocyte enhncer fctor 2D, trnscript vrint X1 Hypoxnthine phosphoriosyl trnsferse 1 9.4; SAS Institute Inc, Cry, NC). A P vlue less thn 0.05 ws considered s significnt difference etween tretment mens, nd P vlue etween 0.05 nd 0.10 s tendency. Ech vlue of the mesurements is presented s men ± SD. RESULTS As shown in Tle 2, the nlyzed contents of nutrients, especilly, the CP nd AA, in the two experimentl diets were close to the clculted vlues (Tle 1). The initil BW were not different (P = 0.94) etween the two groups of pigs (Tle 4). The finl BW of pigs fed the 2 diets were not different nd overll ADG, ADFI, nd G:F were lso not different. At the eginning of the experiment, there ws no difference in plsm concentrtions of ure N, totl protein, lumin, glucose, totl cholesterol, nd triglycerides etween the pigs fed diets 1 nd 2 (Tle 5). After feeding the experimentl diets for 4 wk, there were no differences in the plsm concentrtions of ure N, lumin, glucose, totl cholesterol, nd triglycerides (P = 0.38 to 0.93), lthough the plsm totl protein concentrtion of the pigs fed diet 2 tended to e higher thn tht of the pigs fed diet 1 (P = 0.10). The overll results indicted tht the pigs fed the l-met supplemented diet hd plsm concentrtions of these six metolites tht were not different from tht of pigs fed the dl-met supplemented diet. At the eginning of the experiment, there were no differences (P = 0.12 to 0.98) in plsm MEF2A NM_ GGTGCTGACGGGTACAACTT AATTCCTGCATTCGTTCCTG MEF2B XM_ GCTCTGCGACTGTGAGATTG GTCTCGAGGATGTCGGTGTT MEF2C NM_ CCAGGCAGCAAGAATACGAT TTGTTGAAATGGCTGATGGA MEF2D XM_ AAGAGGAAGTTCGGGCTGAT CTCCGTGTACTTGAGCAGCA HPRFT1 NM_ GCTATGCCCTTGACTACAATGA TTGAACTCTCCTCTTAGGCTTTG All these RefSeq sequences re porcine (Sus scrof) specific from NCBI ( Forwrd nd reverse primers for ech of the nine genes re presented in the 5 to 3 direction. concentrtions of AA etween the two groups of pigs (Tle 6). At the end of the experiment, plsm concentrtions of ll these AAs were still not different etween the two groups of pigs (Tle 7; P = 0.20 to 0.99), which indicted tht the AA metolism nd protein synthesis were not ltered y the Met forms. Before the feeding tril, the mrna expression levels of the eight myogenesis-relted genes were similr (P = 0.14 to 1.00) etween the pigs fed diets 1 nd 2 (Tle 8). After the 4-wk feeding tril, there were still no differences (P = 0.18 to 0.94) etween these two groups of pigs in the mrna expression levels of these eight genes (Tle 8). These results indicted tht the dietry supplementtion of l- Met vs. dl-met do not ffect the expression of these genes differently. Growth Performnce DISCUSSION As previously reported, l-met cn e directly used y nimls for metolism nd protein synthesis (Diner nd Ivey, 1992; Stoll et l., 1998; Mrtín- Venegs et l., 2006; Shen et l., 2014; Willke, 2014; Kong et l., 2016; Tin et l., 2016). d-met, however, needs to e converted to l-met vi iochemicl pthwy nd then ecome ioville for metolic processes including muscle growth in pigs (Bker, 2006). The efficiency of metolic utiliztion of exogenous d-met depends on how it
6 118 Yng et l. Tle 4. Growth performnce of the pigs fed l- vs. dl-methionine supplemented diet Dietry tretment Item Diet 1 Diet 2 P vlue Initil BW, kg 21.3 ± ± Finl BW, kg 48.0 ± ± ADG, kg/d 0.95 ± ± ADFI, kg/d 1.71 ± ± G:F 0.56 ± ± Diet 1 = l-methionine supplemented diet; diet 2 = dl-methionine supplemented diet. The clculted dietry stndrdized ilel digestile methionine contents in oth diets 1 nd 2 were 0.37% (s-fed sis). Ech vlue is men ± SD (n = 10). P vlues were otined from Student s t-test. Tle 5. The concentrtions of selected metolites in the lood plsm of growing pigs efore nd fter the 4-wk feeding tril Dietry tretment Metolites Diet 1 Diet 2 P vlue Before the feeding tril Ure N, mg/dl 9.00 ± ± Totl protein, g/dl 4.54 ± ± Alumin, g/dl 2.34 ± ± Glucose, mg/dl ± ± Totl cholesterol, mg/dl 76.1 ± ± Triglycerides, mg/dl 40.3 ± ± After the feeding tril Ure N, mg/dl 6.30 ± ± Totl protein, g/dl 5.46 ± ± Alumin, g/dl 3.37 ± ± Glucose, mg/dl ± ± Totl cholesterol, mg/dl 74.1 ± ± Triglycerides, mg/dl 47.5 ± ± Diet 1 = l-methionine supplemented diet; diet 2 = dl-methionine supplemented diet. The clculted dietry stndrdized ilel digestile methionine contents in oth diets 1 nd 2 were 0.37% (s-fed sis). P vlues were otined from Student s t-test. cn e efficiently trnsformed to l-met. Thus, for dl-met product, composed of 50% d-met nd 50% l-met, the efficcy of its utiliztion relies on the efficiency of the metolic conversion of d-met to l-met. All d-met cn e converted to l-met y pigs (Wretlind nd Rose, 1950; Cho nd Stegink, 1979; Sugiym nd Murmtsu, 1987; Hsegw et l., 2005; Kong et l., 2016). Indeed, the cpcity of the rte-limiting enzyme, i.e., d-mino cid oxidse (d-aaox), to convert d-met to l-met is not limiting in pigs (Fng et l., 2010) nd poultry (Brchet nd Puigserver, 1992) due to the existence of sustntil d-aaox ctivity in different tissues including liver nd kidney (the mjor conversion sites), nd lso in the gstrointestinl trct (stomch, duodenum, jejunum, nd ileum). Although tendency of incresing ADG in wened pigs fed diets contining l-met insted of dl-met ws reported (Reifsnyder et l., 1984; Shen et l., 2014), severl other studies found tht the pigs fed with l-met supplemented diets hd no difference in growth performnce when compred with pigs fed dl-met supplemented diets (Chung nd Bker, 1992; Chen et l., 2013; vn Milgen et l., 2013; Kong et l., 2016, 2016). Htoo nd Morles (2016) lso reported tht the growth performnce of wened pigs fed diets supplemented with sme inclusion levels of dl-met nd l-met were not different nd, thus estimted 100% reltive iovilility of l-met using slope-rtio regression method. Using N-lnce, Tin et l. (2016) demonstrted tht dietry supplementtion with l-met or dl-met (t the sme inclusion level) to Met deficient diet improved N retention nd decresed fecl N excretion, ut there were no differences etween l-met nd dl-met supplemented diets in terms of N retention or fecl N excretion. These results suggested tht l-met nd dl-met s Met sources re eqully ioville for pigs, nd results of the present experiment re consistent with these previous dt. Plsm Metolites nd Free Amino Acids Severl plsm prmeters, such s plsm ure N, totl protein, lumin, totl cholesterol, triglycerides, nd glucose, re indictive of the nutritionl sttus of nimls (Wen et l., 2014; Regmi et l., 2018). It is worth mentioning tht the vlues for these prmeters otined in this study re similr to those otined y Hu et l. (2015), who lso mesured these prmeters in growing pigs. As n indictor of AA utiliztion y pigs, plsm concentrtion of ure N cn e used to identify dietry AA imlnce (Com et l., 1995; Chen et l., 1999, 1999). Plsm lumin ccounts for 60% of totl plsm proteins nd is mjor contriutor for mintining plsm osmotic pressure for ssisting with trnsporting lipids nd steroid hormones (Mtejtschuk et l., 2000; Regmi et l., 2018). The level of plsm lumin is lso good indictor of the effectiveness of dietry protein utiliztion, s well s of the protein synthesis cpcity of the liver (Lowrey et l., 1962; Mhdvi et l., 2012; Regmi et l., 2018). The plsm concentrtions of glucose, triglycerides, nd cholesterol reflect the metolic sttus of energy nd lipids (Wu, 2018). Shen et l. (2014) reported tht pigs fed l- Met supplemented diets hd lower concentrtions of plsm ure N thn the pigs fed dl-met
7 Effects of L- vs. DL-methionine in pigs 119 Tle 6. The concentrtions of free AAs in the lood plsm of growing pigs efore eing fed two experimentl diets AA, nmol/ml Diet 1 Diet 2 P vlue c Lysine 61.8 ± ± Methionine 50.7 ± ± Leucine ± ± Histidine ± ± Phenyllnine 80.3 ± ± Isoleucine 90.5 ± ± Threonine ± ± Vline ± ± Tryptophn 46.0 ± ± Arginine ± ± Citrulline 79.3 ± ± Alnine ± ± Glutmte ± ± Glycine ± ± Asprgine 94.4 ± ± Asprtte 24.2 ± ± β-alnine 29.0 ± ± Glutmine ± ± Ornithine ± ± Serine ± ± Turine ± ± Tyrosine 96.4 ± ± supplemented diets on dy 10 ut not on dy 20. However, Tin et l. (2016) reported tht pigs fed l- Met supplemented diets hd similr plsm concentrtions of lumin, totl protein, nd plsm ure N when compred with pigs fed with dl-met supplemented diets. Results of the present experiment re in greement with the dt from Tin et l. (2016). In this study, pigs fed the l-met supplemented diet hd concentrtions of Met nd ll other AA s well s turine (n end product of Met metolism) tht were not different form tht of pigs fed the dl-met. These results gree with Tin et l. (2016), who reported tht l-met supplementtion did not result in differences in plsm AA concentrtions compred with pigs fed the dl-met supplemented diets, which indicted tht dl-met nd l-met provide quntities of l-met tht re not different. Results otined from this study indicte tht the effects of l-met nd dl-met on AA, lipid, nd energy metolism re not different. Myogenic Gene Expression Myogenesis, the process of muscle growth, is regulted y rod spectrum of cell signling Dietry tretment Diet 1 = l-methionine supplemented diet; diet 2 = dl-methionine supplemented diet. The clculted dietry stndrdized ilel digestile methionine contents in oth diets 1 nd 2 were 0.37% (s-fed sis). Ech vlue is men ± SD (n = 10). c P vlues were otined from Student s t-test. molecules (Bentzinger et l., 2012). Among the hierrchicl interctions etween those molecules, the fmilies of myogenic regultory fctors (MRF) nd myocyte enhncer fctor 2 (MEF2) for the trnscription fctor medited regultion re key regultors of muscle growth nd development nd hve een focus of mny previous studies in humns nd nimls (Townley-Tilson et l., 2010; Wen et l., 2014). However, little is known out the effects of Met on the expressions of these fctors in swine. The MEF2 fmily comprise Mef2A, Mef2B, Mef2C, nd Mef2D, wheres the MRF fmily comprise myogenic differentition 1 (MyoD1), myogenic fctor 5 (Myf5), myogenin (MyoG), nd muscle regultory fctor 4 (Mrf4,.k.. Myf6). Genes in the MRF fmily re highly conserved nd re collectively expressed in the skeletl muscle of humns (Bentzinger et l., 2012). Assisted y the MEF2 fmily of trnscription fctors (together with other generl nd muscle-specific fctors), MRFs coordinte the ctivities of host of coctivtors nd corepressors, resulting in tight control of gene expression during myogenesis (Blck nd Olson, 1998; Berkes nd Tpscott, 2005).
8 120 Yng et l. Tle 7. The concentrtions of free AAs in the lood plsm of growing pigs fter eing fed two experimentl diets for 4 wk AA, nmol/ml Diet 1 Diet 2 P vlue c Lysine ± ± Methionine 52.6 ± ± Leucine ± ± Histidine ± ± Phenyllnine 67.8 ± ± Isoleucine ± ± Threonine ± ± Vline ± ± Tryptophn 77.9 ± ± Arginine ± ± Citrulline 63.7 ± ± Alnine ± ± Glutmte ± ± Glycine ± ± Asprgine 93.4 ± ± Asprtte 33.8 ± ± β-alnine 40.2 ± ± Glumine ± ± Ornithine ± ± Serine ± ± Turine ± ± Tyrosine ± ± Tle 8. The mrna expression of selected myogenesis genes y the pigs fed l- or dl-methionine supplemented diet efore nd fter the 4-wk feeding tril Gene nme Dietry tretment Diet 1 = l-methionine supplemented diet; diet 2 = dl-methionine supplemented diet. The clculted dietry stndrdized ilel digestile methionine contents in oth diets 1 nd 2 were 0.37% (s-fed sis). Ech vlue is men ± SD (n = 10). c P vlues were otined from Student s t-test. Dietry tretment Gene symol Diet 1 Diet 2 P vlue Before the feeding tril (dy 0) Myogenic differentition 1 MYOD ± ± Myogenin MYOG 1.09 ± ± Myogenic fctor 5 MYF ± ± Myogenic regultory fctor 4 MRF ± ± Myocyte enhncer fctor 2A MEF2A 4.36 ± ± Myocyte enhncer fctor 2B MEF2B 1.58 ± ± Myocyte enhncer fctor 2C MEF2C 1.14 ± ± Myocyte enhncer fctor 2D, trnscript vrint X1 MEF2D 1.58 ± ± After the feeding tril (dy 28) Myogenic differentition 1 MYOD ± ± Myogenin MYOG 1.22 ± ± Myogenic fctor 5 MYF ± ± Myogenic regultory fctor 4 MRF ± ± Myocyte enhncer fctor 2A MEF2A 0.66 ± ± Myocyte enhncer fctor 2B MEF2B 0.53 ± ± Myocyte enhncer fctor 2C MEF2C 2.39 ± ± Myocyte enhncer fctor 2D, trnscript vrint X1 MEF2D 0.90 ± ± Diet 1 = l-methionine supplemented diet; diet 2 = dl-methionine supplemented diet. The clculted dietry stndrdized ilel digestile methionine contents in oth diets 1 nd 2 were 0.37% (s-fed sis). P vlues were otined from Student s t-test.
9 Effects of L- vs. DL-methionine in pigs 121 The lck of difference in the expression of myogenesis-relted genes in pigs fed the two sources of Met indictes tht there is no difference etween l-met nd dl-met in terms of their effects on the muscle growth nd development of growing pigs. These gene expression dt together with the performnce dt indicte tht d-met cn e efficiently converted into l-met to provide enough ioville Met for pig myogenesis. CONCLUSIONS Results of this experiment indicte tht equl dietry supplementtion of l-met or dl-met to Met deficient diet results in growth performnce of young pigs tht is not different. Pigs fed the dl-met supplemented diet lso hd nutritionl sttus tht ws not different from tht of pigs fed the l-met supplemented diet s indicted y plsm concentrtions of AA tht were not different. Expression of myogenesis genes y the pigs ws not differently ffected y the two Met sources either. With no difference in nutritionl ioefficcy etween l-met nd dl-met, the selection etween the two sources for feeding pigs cn e exchngele, ssuming tht the commercil prices for the two sources of Met re the sme. ACKNOWLEDGMENTS This reserch ws finncilly supported in prt y U.S. Deprtment of Agriculture- Ntionl Institute of Food nd Agriculture Htch/Multistte Project nd the Evonik Nutrition & Cre GmH (Hnu-Wolfgng, Germny). Authors wish to thnk Mr Willim White (Frm Mnger, Leveck Animl Reserch Center, Mississippi Stte University) nd the collegues for their excellent support in fcility nd niml mngement. Conflict of interest sttement. None declred LITERATURE CITED Artiss, J. D., nd B. Zk Mesurement of cholesterol concentrtion. In: N. Rifi, editor, Hndook of lipoprotein testing.wshington, DC: AACC Press. p Bker, D. H Comprtive species utiliztion nd toxicity of sulfur mino cids. J. Nutr. 136(6 Suppl):1670S 1675S. doi: /jn/ s Bentzinger, C. F., Y. X. Wng, nd M. A. Rudnick Building muscle: moleculr regultion of myogenesis. Cold Spring Hr. Perspect. Biol. 4: doi: / cshperspect Berkes, C. A., nd S. J. Tpscott Myod nd the trnscriptionl control of myogenesis. Semin. Cell Dev. Biol. 16: doi: /j.semcd Blck, B. L., nd E. N. Olson Trnscriptionl control of muscle development y myocyte enhncer fctor-2 (MEF2) proteins. Annu. Rev. Cell Dev. Biol. 14: doi: /nnurev.cellio Brchet, P., nd A. Puigserver Regionl differences for the D-mino cid oxidse-ctlysed oxidtion of D-methionine in chicken smll intestine. Comp. Biochem. Physiol. B. 101: doi: / (92)90329-p Burnett, D. D., C. B. Pulk, M. D. Tokch, J. L. Nelssen, M. A. Vughn, K. J. Phelps, S. S. Dritz, J. M. DeRouchey, R. D. Goodnd, K. D. Hydon, et l Effects of dded zinc on skeletl muscle morphometrics nd gene expression of finishing pigs fed rctopmine-hcl. Anim. Biotechnol. 27: doi: / Chen, H. Y., A. J. Lewis, P. S. Miller, nd J. T. Yen The effect of excess protein on growth performnce nd protein metolism of finishing rrows nd gilts. J. Anim. Sci. 77: doi: / x Chen, H. Y., A. J. Lewis, P. S. Miller, nd J. T. Yen The effect of infusion of ure into the ven cv on feed intke of finishing gilts. J. Anim. Sci. 77: doi: / x Chen, Y., X. Pio, P. Zho, nd Z. Zeng Efficiency estimtion nd effects of stndrdized ilel digestile methionine level on growth performnce, nutrient digestiility nd plsm prmeters of wener piglets. Chinese J. Anim. Nutr. 25: Cho, E. S., nd L. D. Stegink D-methionine utiliztion during prenterl nutrition in dult rts. J. Nutr. 109: doi: /jn/ Chung, T. K., nd D. H. Bker Efficiency of dietry methionine utiliztion y young pigs. J. Nutr. 122: doi: /jn/ Chung, T. K., nd D. H. Bker Utiliztion of methionine isomers nd nlogs y the pig. Cn. J. Anim. Sci. 72: doi: /cjs Com, J., D. R. Zimmermn, nd D. Crrion Reltionship of rte of len tissue growth nd other fctors to concentrtion of ure in plsm of pigs. J. Anim. Sci. 73: doi: / x Di, Z. L., Z. L. Wu, S. C. Ji, nd G. Wu Anlysis of mino cid composition in proteins of niml tissues nd foods s pre-column o-phthldildehyde derivtives y HPLC with fluorescence detection. J. Chromtogr. B Anlyt. Technol. Biomed. Life Sci. 964: doi: /j.jchrom Diner, J. J., nd F. J. Ivey Cpcity in the liver of the roiler chick for conversion of supplementl methionine ctivity to L-methionine. Poult. Sci. 71: doi: /ps Fng, Z., H. Luo, H. Wei, F. Hung, Z. Qi, S. Jing, nd J. Peng Methionine metolism in piglets fed DL-methionine or its hydroxy nlogue ws ffected y distriution of enzymes oxidizing these sources to keto-methionine. J. Agric. Food Chem. 58: doi: /jf903317x Hsegw, H., Y. Shinohr, K. Akhne, nd T. Hshimoto Direct detection nd evlution of conversion of D-methionine into L-methionine in rts y stle isotope methodology. J. Nutr. 135: doi: / jn/ Htoo, J. K., nd J. Morles Biovilility of L-methionine reltive to DL-methionine s
10 122 Yng et l. methionine source for wened pigs. J Anim. Sci. 94: doi: /js Hu, S. D., X. L. Li, R. Rezei, C. J. Meininger, C. J. McNel, nd G. Wu Sfety of long-term dietry supplementtion with L-rginine in pigs. Amino Acids. 47: doi: /s Kli, V., nd C. S. Pundir Determintion of serum triglycerides using lipse, glycerol kinse, glycerol-3-phosphte oxidse nd peroxidse co-immoilized onto lkylmine glss eds. Indin J. Biochem. Biophys. 41: Kim, B. G., M. D. Lindemnn, M. Rdemcher, J. J. Brennn, nd G. L. Cromwell Efficcy of DL-methionine hydroxy nlog free cid nd DL-methionine s methionine sources for pigs. J. Anim. Sci. 84: doi: / x Kong, C., J. Y. Ahn, nd B. G. Kim Biovilility of D-methionine reltive to L-methionine for nursery pigs using the slope-rtio ssy. PeerJ. 4:e2368. doi: / peerj.2368 Kong, C., C. S. Prk, J. Y. Ahn, nd B. G. Kim Reltive iovilility of DL-methionine compred with l-methionine fed to nursery pigs. Anim. Feed Sci. Technol. 215: doi: /j.nifeedsci Li, Y., F. Li, L. Wu, H. Wei, Y. Liu, T. Li, B. Tn, X. Kong, K. Yo, S. Chen, F. Wu, Y. Dun, nd Y. Yin Effects of dietry protein restriction on muscle fier chrcteristics nd mtorc1 pthwy in the skeletl muscle of growing-finishing pigs. J. Anim. Sci. Biotechnol. 7: doi: /s Lio, S. F., A. K. Kies, W. C. Suer, Y. C. Zhng, M. Cervntes, nd J. M. He Effect of phytse supplementtion to low- nd high-phytte diet for growing pigs on the digestiilities of crude protein, mino cids, nd energy. J. Anim. Sci. 83: doi: / x Lio, S. F., T. Wng, nd N. Regmi Lysine nutrition in swine nd the relted monogstric nimls: muscle protein iosynthesis nd eyond. Springerplus 4:147. doi: / s Lowrey, R. S., W. G. Pond, R. H. Brnes, L. Krook, nd J. K. Loosli Influence of cloric level nd protein qulity on the mnifesttions of protein deficiency in the young pig. J. Nutr. 78: doi: /jn/ Mhdvi, A., M. Shivzd, F. Alemi, M. Zghri, H. Morvej, nd B. Drighne Digestile lysine requirement of roilers sed on prcticl diet. Itl. J. Anim. Sci. 11: doi: /ijs.2012.e13 Mrtín-Venegs, R., P. A. Gerert, nd R. Ferrer Conversion of the methionine hydroxy nlogue DL-2- hydroxy-(4-methylthio) utnoic cid to sulfur-contining mino cids in the chicken smll intestine. Poult. Sci. 85: doi: /ps/ Mtejtschuk, P., C. H. Dsh, nd E. W. Gscoigne Production of humn lumin solution: continully developing colloid. Br. J. Anesth. 85: doi: /j/ vn Milgen, J., J. Nolet, P. Looten, P. Fuertes, nd C. Delporte Comprtive efficcy of L-methionine nd DL-methionine in piglets. Journ. Rech. Porcine. 45: NRC Nutrient requirements of swine, 11th ed. Wshington, DC: The Ntionl Acdemies Press. doi: /13298 Nygrd, A. B., C. B. Jørgensen, S. Cirer, nd M. Fredholm Selection of reference genes for gene expression studies in pig tissues using SYBR green qpcr. BMC Mol. Biol. 8:67. doi: / O Connor, P. M., S. R. Kimll, A. Surywn, J. A. Bush, H. V. Nguyen, L. S. Jefferson, nd T. A. Dvis Regultion of trnsltion initition y insulin nd mino cids in skeletl muscle of neontl pigs. Am. J. Physiol. Endocrinol. Met. 285:E40 E53. doi: / jpendo Reifsnyder, D. H., C. T. Young, nd E. E. Jones The use of low protein liquid diets to determine the methionine requirement nd the efficcy of methionine hydroxy nlogue for the three-week-old pig. J. Nutr. 114: doi: /jn/ Regmi, N., T. Wng, M. A. Crenshw, B. J. Rude, nd S. F. Lio Effects of dietry lysine levels on the concentrtions of selected nutrient metolites in lood plsm of ltestge finishing pigs. J. Anim. Physiol. Anim. Nutr. (Berl). 102: doi: /jpn Shen, Y. B., A. C. Wever, nd S. W. Kim Effect of feed grde L-methionine on growth performnce nd gut helth in nursery pigs compred with conventionl DL-methionine. J. Anim. Sci. 92: doi: /js Stoll, B., J. Henry, P. J. Reeds, H. Yu, nd F. Jhoor Ctolism domintes the first-pss intestinl metolism of dietry essentil mino cids in milk protein-fed piglets. J. Nutr. 128: doi: /jn/ Sugiym, K., nd K. Murmtsu Effects of excess D- nd L-methionine diets on growth nd heptic enzyme ctivities in rts. Agric. Biol. Chem. 51: doi: / Tin, Q. Y., Z. K. Zeng, Y. X. Zhng, S. F. Long, nd X. S. Pio Effect of L- or DL-methionine supplementtion on nitrogen retention, serum mino cid concentrtions nd lood metolites profile in strter pigs. Asin-Austrls. J. Anim. Sci. 29: doi: /js Tietz, N. W Clinicl guide to lortory tests. 3rd ed. Phildelphi, PA: W.B. Sunders. Todd, J. C., A. H. Snford, I., Dvidsohn, nd J. B. Henry Clinicl dignosis nd mngement y lortory methods. 16th ed. Phildelphi, PA: Sunders. Townley-Tilson, W. H., T. E. Cllis, nd D. Wng Microrns 1, 133, nd 206: criticl fctors of skeletl nd crdic muscle development, function, nd disese. Int. J. Biochem. Cell Biol. 42: doi: /j. iocel Wen, C., X. Chen, G. Y. Chen, P. Wu, Y. P. Chen, Y. M. Zhou, nd T. Wng Methionine improves rest muscle growth nd lters myogenic gene expression in roilers. J. Anim. Sci. 92: doi: /js Willke, T Methionine production criticl review. Appl. Microiol. Biotechnol. 98: doi: / s y Wretlind, K. A., nd W. C. Rose Methionine requirement for growth nd utiliztion of its opticl isomers. J. Biol. Chem. 187: Wu, G Principles of niml nutrition. Boc Rton, FL: CRC Press. Wu, G., nd C. J. Meininger Anlysis of citrulline, rginine, nd methylrginines using high-performnce liquid chromtogrphy. Methods Enzymol. 440: doi: /s (07)
11 Effects of L- vs. DL-methionine in pigs 123 Zhi, W., L. F. Arujo, S. C. Burgess, A. M. Cooksey, K. Pendrvis, Y. Mercier, nd A. Corzo Protein expression in pectorl skeletl muscle of chickens s influenced y dietry methionine. Poult. Sci. 91: doi: /ps Zimmermnn, B., R. Mosenthin, M. Rdemcher, P. B. Lynch, nd E. Esteve-Grci Comprtive studies on the reltive efficcy of DL-methionine nd liquid methionine hydroxyl nlogue in growing pigs. Asin-Austrls. J. Anim. Sci. 18: doi: /js
USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationRoughage Type & Level & Grain Processing Interactions with Distiller s s Grains Diets. Matt May High Plains Bio Fuels Co-Product Nutrition Conference
Roughge Type & Level & Grin Processing Interctions with Distiller s s Grins Diets Mtt My High Plins Bio Fuels Co-Product Nutrition Conference Why do we flke grin? Stem-flked corn (SFC) vs. dry-rolled rolled
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationEffects of Dietary Protein and Energy on Growth Performance and Carcass Characteristics of Betong Chickens (Gallus domesticus) During Growing Period
Interntionl Journl of Poultry Science 9 (5): 468-472, 2010 ISSN 1682-8356 Asin Network for Scientific Informtion, 2010 Effects of Dietry Protein nd Energy on Growth Performnce nd Crcss Chrcteristics of
More informationENERGY CONTENT OF BARLEY
ENERGY CONTENT OF BARLEY VARIATION IN THE DIETARY ENERGY CONTENT OF BARLEY Shwn Firbirn, John Ptience, Hnk Clssen nd Ruurd Zijlstr SUMMARY Formultion of commercil pig diets requires n incresing degree
More informationEffect Of MiCroPlex Chromium Methionine And Vitamin E Supplementation On Growth Performance And Immune Status Of Stressed Beef Calves
Effect Of MiCroPlex Chromium Methionine And Vitmin E Supplementtion On Growth Performnce And Immune Sttus Of Stressed Beef Clves Z BCr - 16 Ojective Evlute MiCroPlex nd vitmin E effects on growth nd immune
More informationSupporting information
Supporting informtion Multiple Univrite Dt Anlysis Revels the Inulin Effects on the High-ft-diet Induced Metolic Altertions in Rt Myocrdium nd Testicles in the Pre-oesity Stte Yixun Dun #, Ynpeng An #,
More informationBioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM
Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms
More informationEffect of Mannan Oligosaccharide (Bio-Mos) Addition With and Without Zinc Oxide on Performance and Immunocompetence of Weanling Pigs
Effect of Mnnn Oligoscchride (Bio-Mos) Addition With nd Without Zinc Oxide on Performnce nd Immunocompetence of Wenling Pigs E. Dvis, C. Mxwell, B. de Rods, nd D. Brown 1 Story in Brief An experiment involving
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationDigestible Sulfur Amino Acid Requirement of Male Turkeys During the 12 to 18 Week Period
Interntionl Journl of Poultry Science (): 8-, 00 Asin Network for Scientific Informtion 00 Digestible Sulfur Amino Acid Requirement of Mle Turkeys During the to 8 Week Period D. T. Moore, K. Bker, K. Thompson,
More informationAmino Acid Density and L-Threonine Responses in Ross Broilers 1,2
Interntionl Journl of Poultry Science (): 8-6, 00 ISSN 68-86 Asin Network for Scientific Informtion, 00 Amino Acid Density nd L-Threonine Responses in Ross Broilers, M.T. Kidd, W.S. Virden, A. Corzo, W.A.
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationNutrition Guide. National Swine. Protein and Amino Acid Sources for Swine Diets. Introduction. Objectives. Amino Acid Sources
Ntionl Swine Nutrition Guide Protein nd Amino Acid Sources for Swine Diets Introduction Authors Mrci C. Shnnon, University of Missouri Gry L. Allee, University of Missouri Reviewers R. Den Boyd, The Hnor
More informationChronic high-sodium diet intake after weaning lead to neurogenic hypertension in adult Wistar rats
Chronic high-sodium diet intke fter wening led to neurogenic hypertension in dult Wistr rts 1 Pul Mglhães Gomes; 2 Rento Willin Mrtins Sá; 1 Giovn Lopes Aguir; 1 Milede Hnner Sriv Pes; 1 Andréi Crvlho
More informationThe Ever Changing World of Feed Additives in The Poultry Industry
The Ever Chnging World of Feed Additives in The Poultry Industry B. S. Lumpkins nd G.F. Mthis Southern Poultry Reserch Inc. Athens, GA, USA Outline Southern Poultry Reserch Impct of ethnol production of
More informationEvaluation of Sun and Oven-Dried Broiler Offal Meal as Replacement for Fishmeal in Broiler and Layer Rations
Interntionl Journl of Poultry Science 5 (7): 646-650, 2006 ISSN 1682-8356 Asin Network for Scientific Informtion, 2006 Evlution of Sun nd Oven-Dried Broiler Offl Mel s Replcement for Fishmel in Broiler
More information3/10/ Energy metabolism o How to best supply energy to the pig o How the pig uses energy for growth
Keeping Control of Feed Costs in n Uncertin Mrket Presented To: Iow Pork Producers Assocition Regionl Meetings Februry, 2009 John F. Ptience Iow Stte University Ames, IA Outline Wht s new in swine nutrition
More informationInfluence of $-Adrenergic Agonist (Metaproterenol) and Lysine on Growth, Carcass Quality in Broiler Chickens
Interntionl Journl of Poultry Science 5 (11): 1082-1086, 2006 ISSN 1682-856 Asin Network for Scientific Informtion, 2006 Influence of $-Adrenergic Agonist (Metproterenol) nd Lysine on Growth, Crcss Qulity
More informationThe Effects of High-Oil Corn or Typical Corn with or without Supplemental Fat on Diet Digestibility in Finishing Steers
Beef Reserch Report, 2000 Animl Science Reserch Reports 2001 The Effects of High-Oil Corn or Typicl Corn with or without Supplementl Ft on Diet Digestibility in Finishing Steers Crig R. Belknp Iow Stte
More informationShamsuddin M. Mamun, U. Focken, G. Francis and K. Becker University of Hohenheim, Stuttgart, Germany. September 2004
A GROWTH PERFORMANCE AND METABOLIC RATES OF GENETICALLY IMPROVED AND CONVENTIONAL STRAINS OF NILE TILAPIA, OREOCHROMIS NILOTICUS (L.) Shmsuddin M. Mmun, U. Focken, G. Frncis nd K. Becker University of
More informationConsumer perceptions of meat quality and shelf-life in commercially raised broilers compared to organic free range broilers
Consumer perceptions of met qulity nd shelf-life in commercilly rised roilers compred to orgnic free rnge roilers C.Z. ALVARADO 1 *, E. WENGER 2 nd S. F. O KEEFE 3 1 Texs Tech University, Box 42141 Luock,
More informationProducts for weaners Benzoic acid or the combination of lactic acid and formic acid
Products for weners Benzoic cid or the comintion of lctic cid nd formic cid Tril report no.: 490 Novemer, 000 Hnne Mrio, Lrs Egelund Olsen, Bent Borg Jensen 1 nd Nuri Miquel 1 The Ntionl Committee for
More informationReduction in Dietary Nutrient Density Aids in Utilization of High Protein Cottonseed Meal in Broiler Diets 1
Interntionl Journl of Poultry Science (4) : 53-58, 2002 sin Network for Scientific Informtion 2002 Reduction in Dietry Nutrient Density ids in Utiliztion of High Protein Cottonseed Mel in roiler Diets
More informationThe Effects of Metabolizable Energy Inclusion Rates on Feed Efficiency in Broilers
The Effects of Metolizle Energy Inclusion Rtes on Feed Efficiency in Broilers Presented y: Molly Cutter, Kevin Ksch, Eric Frzier, Sr Ludington, Michelle Sirum, Linne Olson Astrct: An experiment ws conducted
More informationResponse of Commercial Egg-Type Pullets to Diets Varying in Protein and Energy Content in Arid Hot Climate
Interntionl Journl of Poultry Science 8 (9): 90-98, 2009 ISSN 682-8356 sin Network for Scientific Informtion, 2009 Response of Commercil Egg-Type Pullets to Diets Vrying in Protein nd Energy Content in
More informationInput from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
More informationMecadox. Improves pig performance in a wide range of health and growing conditions. (Carbadox) Talk With a Phibro Expert:
SWINE (Crbdox) Improves pig performnce in wide rnge of helth nd growing conditions The Advntge Over the yers, medicted feed dditive hs proven to be cost-effective mngement tool for improving pig performnce
More informationIbrahim, I. Hamid Animal Production Research Center-Khartoum North, Sudan
Interntionl Journl of Poultry Science 13 (8): 484-488, 2014 ISSN 1682-8356 Asin Network for Scientific Informtion, 2014 Investigtions into the Addition of Herl Methionine (Phytonin) As Sustitute of Synthetic
More informationChoice Feeding of Two Different Broiler Strains Using Diets with Constant Energy Level 1
Interntionl Journl of Poultry Science 7 (8): 726-737, 2008 ISSN 1682-8356 Asin Network for Scientific Informtion, 2008 Choice Feeding of Two Different Broiler Strins Using Diets with Constnt Energy Level
More informationEffects of Different Sources and Levels of Selenium on Performance, Thyroid Function and Antioxidant Status in Stressed Broiler Chickens
Interntionl Journl of Poultry Science 8 (6): 583-587, 2009 ISSN 1682-8356 Asin Network for Scientific Informtion, 2009 Effects of Different Sources nd Levels of Selenium on Performnce, Thyroid Function
More informationEffect of processing on in vitro bioaccessibility of phenolics, flavonoids and antioxidant activity of vegetables with/without yoghurt
Effect of processing on in vitro ioccessiility of phenolics, flvonoids nd ntioxidnt ctivity of vegetles with/without yoghurt Assoc. Prof. Dr. Esr ÇAPANOĞLU GÜVEN Deprtment of Food Engineering Istnul Technicl
More informationEffect of high doses of Natuphos E 5,000 G phytase on growth performance of nursery pigs
Effect of high doses of Ntuphos E 5,000 G phytse on growth performnce of nursery pigs Kih M. Gourley,,1 Json C. Woodworth, Joel M. DeRouchey, Steve S. Dritz, Mike D. Tokch, nd Roert D. Goodnd Deprtment
More informationEffect of Different Dietary Energy Sources on Induction of Fatty Liver-Hemorrhagic Syndrome in Laying Hens
Interntionl Journl of Poultry Science 7 (12): 1232-1236, 2008 ISSN 1682-8356 sin Network for Scientific Informtion, 2008 Effect of Different Dietry Energy Sources on Induction of Ftty Liver-Hemorrhgic
More informationEffect of linear and random non-linear programming on environmental pollution caused by broiler production
Journl of Novel Applied Sciences Aville online t www.jnsci.org 24 JNAS Journl-24-3-/43-434 ISSN 2322-549 24 JNAS Effect of liner nd rndom non-liner progrmming on environmentl pollution cused y roiler production
More informationAOAC Official Method Determination of Isoflavones in Soy and Selected Foods Containing Soy
45.4.14 AOAC Officil Method 2001.10 Determintion of Isoflvones in Soy nd Selected Foods Contining Soy Extrction, Sponifiction, nd Liquid Chromtogrphy First Action 2001 (Applicble to the determintion of
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationThe Effects of Dietary Protein and Lysine Levels on Broiler Performance, Carcass Characteristics and N Excretion
Interntionl Journl of Poultry Science 3 (): 148-15, 004 Asin Network for Scientific Informtion 004 The Effects of Dietry Protein nd Lysine Levels on Broiler Performnce, Crcss Chrcteristics nd N Excretion
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationStandardized ileal digestible valine:lysine dose response effects in 25- to 45-kg pigs under commercial conditions
Stndrdized ilel digestible vline:lysine dose response effects in 25- to 45-kg pigs under commercil conditions Mrcio A. D. Gonçlves, Mike D. Tokch, Steve S. Dritz,,1 Nor M. Bello, Kevin J. Touchette, $
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationdoi: /s British Journal of Nutrition (2016), 115, The Authors 2016
British Journl of Nutrition (2016), 115, 2236 2245 The Authors 2016 doi:10.1017/s0007114516000842 Supplementtion of rnched-chin mino cids to reduced-protein diet improves growth performnce in piglets:
More informationDecreasing Diet Density: Direct Fed Microbials and L-Threonine 1,2
Interntionl Journl of Poultry Science 9 (): -9, 00 ISSN 68-86 Asin Network for Scientific Informtion, 00 Decresing Diet Density: Direct Fed Microils nd L-Threonine, 4 4,4 4 6 M.T. Kidd, A. Corzo, W.A.
More informationEvaluation of Faba Beans, White Lupins and Peas as Protein Sources in Broiler Diets
Interntionl Journl of Poultry Science 9 (6): 567-573, 00 ISSN 68-8356 Asin Network for Scientific Informtion, 00 Evlution of F Bens, White Lupins nd Pes s Protein Sources in Broiler Diets C.L. Nlle, V.
More informationBackground Pears (Pyrus L.) are one of the leading cultivated fruit trees in China following apples and oranges in planting area and fruit yield.
Nnjing Agriculturl University Potssium enhnces the sugr ssimiltion in leves nd fruit y regulting the expression of key genes involved in sugr metolism of Asin pers Cixi Dong, Chngwei Shen, Yngchun Xu College
More informationSupplementation and Cooking of Pearl Millet: Changes in Protein Fractions and Sensory Quality
World Journl of Diry & Food Sciences 4 (1): 41-45, 29 ISSN 1817-38X IDOSI Pulictions, 29 Supplementtion nd Cooking of Perl Millet: Chnges in Protein Frctions nd Sensory Qulity Mh A.M. Ali, Adullhi H. El
More informationSoybean Hulls as an Alternative Feed for Horses
Animl Industry Report AS 650 ASL R1931 2004 Soyben Hulls s n Alterntive Feed for Horses Josie Booth Iow Stte University Howrd Tyler Iow Stte University Peggy Miller-Auwerd Iow Stte University Jenette Moore
More informationPNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 :
PNEUMOVAX 23 is recommended y the CDC for ll your pproprite dult ptients t incresed risk for pneumococcl disese 1,2 : Adults ged
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationEFFECTS OF PEPSOYGEN AND DRIED PORCINE SOLUBLES 50 IN NURSERY PIG DIETS 1
Swine Day 2008 EFFECTS OF PEPSOYGEN AND DRIED PORCINE SOLUBLES 50 IN NURSERY PIG DIETS 1 C. K. Jones, J. M. DeRouchey, J. L. Nelssen, M. D Tokach, S. S. Dritz 2, and R. D. Goodband Summary Two experiments
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationThe Effects of Diet Particle Size on Animal Performance
MF-2050 Feed Mnufcturing Feed Mnufcturing Cerel grins re the primry energy source in swine nd poultry diets. Therefore, not only must producers be concerned bout the composition of the grin, but lso how
More informationEffect of Mannanase on Broiler Performance, Ileal and In-vitro Protein Digestibility, Uric Acid and Litter Moisture in Broiler Feeding
Interntionl Journl of Poultry Science 4 (1): 21-26, 2005 Asin Network for Scientific Informtion, 2005 Effect of Mnnnse on Broiler Performnce, Ilel nd In-vitro Protein Digestiility, Uric Acid nd Litter
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationA COMPARISON OF WHEY PROTEIN CONCENTRATE AND SPRAY-DRIED ANIMAL PLASMA IN DIETS FOR WEANLING PIGS 1
Swine Day 2004 A COMPARISON OF WHEY PROTEIN CONCENTRATE AND SPRAY-DRIED ANIMAL PLASMA IN DIETS FOR WEANLING PIGS 1 R. O. Gottlob, J. M. DeRouchey, M. D. Tokach, R. D. Goodband, S. S. Dritz 2, J. L. Nelssen,
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationMeseret Girma, Berhan Tamir and Tadelle Dessie 1. Department of Animal Sciences, Wollo University, P.O. Box 1145, Dessie, Ethiopia 2
Interntionl Journl of Poultry Science 11 (1): 65-72, 2012 ISSN 1682-8356 Asin Network for Scientific Informtion, 2012 Effects of Replcing Penut Seed Cke with Brewery Dried Yest on Lying Performnce, Egg
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationA. Kinoshita 1, L. Locher 2, R. Tienken 3, U. Meyer 3, S. Dänicke 3, J. Rehage 4, K. Huber 5
Effects of dietry nicin supplementtion on heptic expression of FoxO nd genes involved in glucose production in diry cows during the trnsition period A. Kinoshit, L. Locher, R. Tienken 3, U. Meyer 3, S.
More informationNozzi Valentina, Graber Andreas, Mathis Alex, Schmautz Zala, Junge Ranka
Nozzi Vlentin, Grer ndres, Mthis lex, Schmutz Zl, Junge Rnk Interntionl conference quponics reserch mttes Ljuljn, 22-24 Mrch 216 Some nutrients from the quculture effluents re present in insufficient quntities
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationEvaluation of Heparin Production By-Products in Nursery Pig Diets 1
Evaluation of Heparin Production By-Products in Nursery Pig Diets A. J. Myers, M. D. Tokach, R. D. Goodband, M.U. Steidinger, S. S. Dritz, J. M. DeRouchey, J. L. Nelssen, B. W. Ratliff, and D. M. McKilligan
More informationAquaculture protein levels
Ž. Aquculture 189 2000 287 292 www.elsevier.nlrlocterqu-online Whole-ody mino cid pttern of F4 humn growth hormone gene-trnsgenic red common crp ž Cyprinus crpio/ fed diets with different protein levels
More informationEFFECT OF PHOTOPERIOD AND TRYPTOPHAN AMINO ACID SUPPLEMENTATION ON PINEAL GLAND HORMONE (MELATONIN) AND ITS RELATION TO PERFORMANCE IN LOCAL STRAIN.
Egypt. Poult. Sci. Vol (30) (IV): (927-960) EFFECT OF PHOTOPERIOD AND TRYPTOPHAN AMINO ACID SUPPLEMENTATION ON PINEAL GLAND HORMONE (MELATONIN) AND ITS RELATION TO PERFORMANCE IN LOCAL STRAIN. 1- EFFECT
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationIntroduction. Lance Baumgard. Introduction con t. Research Emphasis at AZ. Teaching and Advising. Research Emphasis at ISU 4/29/2010
Introduction Lnce Bumgrd Associte Professor Ntive of southwest Minnesot BS: U of Minnesot MS: U of Minnesot Advisor: Brin Crooker Thesis: Effects of genetic selection for milk yield on somtotropin prmeters
More informationExpression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationInvasive Pneumococcal Disease Quarterly Report July September 2018
Invsive Pneumococcl Disese Qurterly Report July Septemer Introduction Since 17 Octoer 2008, invsive pneumococcl disese (IPD) hs een notifile to the locl Medicl Officer of Helth under the Helth Act 1956.
More informationEffect of Field Pea Replacement and Yucca schidigera extract on weaning transition growth and feedlot performance
Effect of Field Pe Replcement nd Yucc schidiger extrct on wening trnsition growth nd feedlot performnce D.G. Lndblom 1 nd J. Pennington 2 1 Dickinson Reserch Extension Center, Dickinson, ND 2 Dickinson
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationUse of δ-aminolevulinic Acid in Swine Diet: Effect on Growth Performance, Behavioral Characteristics and Hematological/Immune Status in Nursery Pigs*
97 Use of δ-aminolevulinic Acid in Swine Diet: Effect on Growth Performnce, Behviorl Chrcteristics nd Hemtologicl/Immune Sttus in Nursery Pigs* R. D. Mteo 1, J. L. Morrow 2, J. W. Diley 2, F. Ji 1 nd S.
More informationBright Futures Medical Screening Reference Table 2 to 5 Day (First Week) Visit
Bright Futures Medicl Reference Tle 2 to 5 Dy (First Week) Visit Universl Action Metolic nd Verify documenttion of neworn metolic screening results, pproprite rescreening, nd needed follow-up. Document
More informationInternational Journal of Poultry Science 5 (8): , 2006 ISSN Asian Network for Scientific Information, 2006
Interntionl Journl of Poultry Science 5 (8): 744-75, 006 ISSN 168-8356 Asin Network for Scientific Informtion, 006 Effect of Adding Methionine Hydroxy Anlogue s Methionine Source t the Commercil Requirement
More informationSYNOPSIS Final Abbreviated Clinical Study Report for Study CA ABBREVIATED REPORT
Finl Arevited Clinicl Study Report Nme of Sponsor/Compny: Bristol-Myers Squi Ipilimum Individul Study Tle Referring to the Dossier (For Ntionl Authority Use Only) Nme of Finished Product: Yervoy Nme of
More informationAn Evaluation of Peptone Products and Fish Meal on Nursery Pig Performance 1
An Evaluation of Peptone Products and Fish Meal on Nursery Pig Performance A. J. Myers, M. D. Tokach, R. D. Goodband, S. S. Dritz, J. M. DeRouchey, J. L. Nelssen, J. Moline, G. Xu, B. W. Ratliff, and D.
More informationTHE EFFECTS OF DIETARY GLUTAMINE, GLYCINE, AND SODIUM CHLORIDE CONCENTRATION ON NURSERY PIG GROWTH PERFORMANCE
Swine Research 2005 THE EFFECTS OF DIETARY GLUTAMINE, GLYCINE, AND SODIUM CHLORIDE CONCENTRATION ON NURSERY PIG GROWTH PERFORMANCE C. N. Groesbeck, M. D. Tokach, S. S Dritz 1, J. M. DeRouchey, J. L. Nelssen,
More informationEffects of Feeding Varied Levels of Balanced Protein on Growth Performance and Carcass Composition of Growing and Finishing Pigs 1,2
Effects of Feeding Varied Levels of Balanced Protein on Growth Performance and Carcass Composition of Growing and Finishing Pigs 1,2 N. W. Shelton, J. K. Htoo 3, M. Redshaw 3, R. D. Goodband, M. D. Tokach,
More informationScholarly Research Exchange
Scholrly Reserch Exchnge Volume 9 Article ID 7959 doi:1.3814/9/7959 Reserch Article Different Dietry Levels of Protein to Lipid Rtio Affected Digestive Efficiency, Skeletl Growth, nd Muscle Protein in
More informationInheritance of cholesterol metabolism of probands with high or low cholesterol absorption
Inheritnce of cholesterol metolism of pronds with high or low cholesterol sorption Helen Gylling* nd Ttu A. Miettinen 1, Deprtment of Clinicl Nutrition,* University of Kuopio, nd Kuopio University Hospitl,
More informationThe Effects of Decorticated Sunflower Meal as a Substitute for Groundnut Meal in Broiler Diet
The Effects of Decorticted Sunflower Mel s Sustitute for Groundnut Mel in Broiler Diet Mohmed E. Ahmed, Nivin M. Elfki nd Tlh E. As Astrct An experiment involving 160, one dy old unsexed Hurd roiler chicks
More informationCheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer
CheckMte 53: Rndomized Results of Continuous vs -Yer Fixed-Durtion Nivolumb in Ptients With Advnced Non-Smll Cell Lung Cncer Abstrct 297O Spigel DR, McCleod M, Hussein MA, Wterhouse DM, Einhorn L, Horn
More informationAgilent G6825AA MassHunter Pathways to PCDL Software Quick Start Guide
Agilent G6825AA MssHunter Pthwys to PCDL Softwre Quick Strt Guide Wht is Agilent Pthwys to PCDL? Fetures of Pthwys to PCDL Agilent MssHunter Pthwys to PCDL converter is stnd-lone softwre designed to fcilitte
More informationSingle-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
More informationXII. HIV/AIDS. Knowledge about HIV Transmission and Misconceptions about HIV
XII. HIV/AIDS Knowledge bout HIV Trnsmission nd Misconceptions bout HIV One of the most importnt prerequisites for reducing the rte of HIV infection is ccurte knowledge of how HIV is trnsmitted nd strtegies
More informationHPLC Analysis of Six Active Components of Caulis Lonicerae Using a Phenyl-1 Column
HPLC Anlysis of Six Active Components of Culis Lonicere Using Phenyl- Column Xu Qun, Hung Xiongfeng, nd Jeffrey Rohrer Thermo Fisher Scientific Inc., Shnghi, People s Repulic of Chin Thermo Fisher Scientific
More informationReplacing Fish Meal with Soybean Meal and Brewer s Grains with Yeast in Diets for Australian Red Claw Crayfish, Cherax quadricarinatus
Replcing Fish Mel with Soyben Mel nd Brewer s Grins with Yest in Diets for Austrlin Red Clw Cryfish, Cherx qudricrintus Lur A. Muzinic*, Kenneth R. Thompson, & Crl D. Webster Introduction Soyben mel (SBM)
More informationCOMPARISON OF INTERNATIONAL PROTEIN CORPORATION 740 FISH MEAL AND SPECIAL SELECT MENHADEN FISH MEAL IN NURSERY PIG DIETS
Swine Day 2001 Contents COMPARISON OF INTERNATIONAL PROTEIN CORPORATION 740 FISH MEAL AND SPECIAL SELECT MENHADEN FISH MEAL IN NURSERY PIG DIETS M. G. Young, M. D. Tokach, R. D. Goodband, J. L. Nelssen,
More informationProtein Quality Dynamics During. Grass-Legume Forage
Protein Qulity Dynmics During Wilting nd Preservtion of Grss-Legume Forge Eliset Ndeu 1, Wolfrm Richrdt 2, Michel Murphy 3 nd Horst Auerch 4 1 Swedish University of Agriculturl Sciences, Skr, Sweden 2
More informationResearch Article The Composition Analysis of Maca (Lepidium meyenii Walp.) from Xinjiang and Its Antifatigue Activity
Hindwi Journl of Food Qulity Volume 2017, Article ID 2904951, 7 pges https://doi.org/10.1155/2017/2904951 Reserch Article The Composition Anlysis of Mc (Lepidium meyenii Wlp.) from Xinjing nd Its Antiftigue
More informationEstimates of Methionine and Sulfur Amino Acid Requirements for Laying Hens using Different Models
Brzilin Journl of Poultry Science Revist Brsileir de Ciênci Avícol ISSN 1516-635X Jul - Sept 2012/ v.14 / n.3 / 159-232 Estimtes of Methionine nd Sulfur Amino Acid Requirements for Lying Hens using Different
More information