Supplemental Information. Derivation of Human Trophoblast Stem Cells

Transcription

1 Cell Stem Cell, Volume 22 Supplemental Information Derivation of Human Trophoblast Stem Cells Hiroaki Okae, Hidehiro Toh, Tetsuya Sato, Hitoshi Hiura, Sota Takahashi, Kenjiro Shirane, Yuka Kabayama, Mikita Suyama, Hiroyuki Sasaki, and Takahiro Arima

2

3 Figure S1. Related to Figure 1 (A) Flow cytometry histogram of ITGA6 expression on CT cells isolated from a first trimester placenta. The proportion of ITGA6-positive cells typically exceeded 95% after immunomagnetic enrichment. (B) Flow cytometry histogram of HLA-G expression on EVT cells isolated from a first trimester placenta. The proportion of HLA-G-positive cells typically exceeded 95% after immunomagnetic enrichment. (C) Oblique illumination image of ST cells isolated from a first trimester placenta (top). Note that almost all cells are >40 m in diameter. Immunostaining of the ST marker protein SDC1 on ST cells (bottom). Nuclei were stained with Hoechst The percentage of SDC1-positive cells was typically >80%. (D) Phase-contrast images of CT cells cultured in various conditions as described in Figure 1B. The cells cultured in Condition-1, -7, -8, and -9 were highly proliferative and morphologically indistinguishable. Cell proliferation was significantly suppressed in Condition-3, -4, and -5. (E) Phase-contrast and immunofluorescence images of CT cells cultured in Condition-2 (see Figure 1B) for nine days. These cells expressed the EVT marker HLA-G and were unable to propagate. Nuclei were stained with Hoechst (F) Effects of EGF and inhibitors on the long-term maintenance of proliferative CT cells. Proliferative CT cells were established in the presence of VPA, CHIR99021, A83-01, SB431542, EGF, and Y27632, and were then maintained in the absence of VPA, CHIR99021, A83-01 and SB431542, or EGF. CHIR99021, EGF, and TGF- inhibitors were essential and VPA was important for the long-term maintenance of proliferative CT cells. Data are presented as mean ± SD (n = 3). (G) Phase-contrast images of proliferative CT cells established using TSA or SAHA. CT cells were cultured for about three weeks in the TS medium where VPA was replaced by TSA or SAHA. (H) Phase-contrast images of proliferative CT cells established using either A83-01 or SB CT cells were cultured for about three weeks in the TS medium containing either A83-01 (0.5 M) or SB (10 M). A83-01 was more potent than SB (see Table S2). (I) Chromosome analysis of TS CT cells. Both TS CT #1 and #2 were karyotypically normal after 30 passages. 1

4 The scale bars indicate 100 m. 2

5

6 Figure S2. Related to Figure 2 (A) Phase-contrast and immunofluorescence images of TS CT cells cultured in the TS medium without EGF, CHIR99021, A83-01, SB431542, and VPA. The cells were analyzed at day 4. Some cells were SDC1-negative and remained mononucleated (arrows). The medium did not support the survival of the differentiated cells and most of them died within 5 days. Similar results were obtained with two independent cell lines. (B) Phase-contrast and immunofluorescence images of CT cells treated with the indicated concentrations of A83-01 or SB for nine days. A83-01 or SB was added to the TS medium without CHIR99021, A83-01, SB431542, and VPA. A83-01 increased the number of HLA-G-expressing cells with a mesenchymal-like morphology in a dose-dependent manner. This experiment was repeated three times with similar results. (C) Serial phase-contrast images of TS CT cells differentiating into EVT-TS CT cells. TS CT cells transiently proliferated and differentiated into EVT-like cells with a mesenchymal-like morphology. (D) Effects of A83-01, NRG1 and Matrigel on the differentiation of TS CT cells into EVT-TS CT cells. TS CT cells were cultured in the EVT medium (see Methods for details) without A83-01, NRG1, or Matrigel for five days. Few EVT-like cells emerged in the absence of A NRG1 enhanced the transient proliferation of the differentiating cells. Both EVT- and ST-like cells emerged in the absence of Matrigel. (E) Serial phase-contrast images of TS CT cells differentiating into ST(2D)-TS CT cells. The cells indicated by arrows aggregated and fused to form a large syncytium. (F) Effects of forskolin and EGF on the differentiation of TS CT cells into ST(3D)-TS CT cells. Forskolin and EGF synergistically enhanced the formation of large cyst-like structures. This experiment was repeated three times with similar results. (G) Quantitative real-time PCR analysis of ST markers in ST(2D)-TS CT and ST(3D)-TS CT cells. The expression levels of CGB, CSH1/2, and SDC1 were higher in ST(3D)-TS CT cells than in ST(2D)-TS CT cells. The data were normalized to GAPDH expression. The error bars indicate SD (n = 3). (H) Phase-contrast and immunofluorescence images of EVT-TS CT cells. TS CT cells maintained their ability to differentiate into EVT-TS CT cells after 50 passages. Similar results were obtained with two independent cell lines. (I) Immunostaining of CGB and SDC1 in ST(3D)-TS CT cells. TS CT cells maintained 3

7 their ability to differentiate into ST(3D)-TS CT cells after 53 passages. Similar results were obtained with two independent cell lines. The scale bars indicate 100 m. 4

8

9 Figure S3. Related to Figure 3 (A) Chromosome analysis of TS blast cells. Both TS blast #1 and #2 were karyotypically normal after 30 passages. (B) Representative flow cytometry histogram of HLA-ABC expression on TS blast cells. HLA-ABC expression was low in the cells. Similar results were obtained with two independent cell lines. (C) Phase-contrast images of EVT-like cells derived from TS blast #4 and #7. These lines differentiated into spindle-shaped cells less efficiently than the other TS blast lines. (D) Quantitative real-time PCR analysis of all TS lines derived in this study. We analyzed TP63 and TEAD4 (CT markers), CGB and SDC1 (ST markers), and HLA-G and MMP2 (EVT markers). The data were normalized to GAPDH expression. Although EVT-TS blast #4 and #7 expressed high levels of EVT markers, their TP63 expression levels were comparable to some undifferentiated TS lines (e.g., TS CT #4 and TS blast #1). (E) Phase-contrast and immunofluorescence images of EVT-TS blast cells. TS blast cells maintained their ability to differentiate into EVT-TS blast cells after 55 passages. Similar results were obtained with two independent cell lines. (F) Immunostaining of CGB and SDC1 in ST(3D)-TS blast cells. TS blast cells maintained their ability to differentiate into ST(3D)-TS blast cells after 55 passages. Similar results were obtained with two independent cell lines. The scale bars indicate 100 m. 5

10

11 Figure S4. Related to Figure 4 (A) Heat scatter plots and Pearson correlation coefficients for comparison of gene expression patterns between ST, ST(2D)-TS CT, and ST(3D)-TS CT cells. All genes were considered. Although ST(2D)- and ST(3D)-TS CT cells had very similar transcriptome profiles, ST(3D)-TS CT cells were a little more similar to ST cells than ST(2D)-TS CT cells. (B) Gene set enrichment analysis (GSEA) comparison between primary and TS-derive cells. The data from TS CT and TS blast cells were combined. Genes were ranked based on DESeq2 log2 fold changes. The top five enriched and depleted gene ontology (GO) terms are shown. GO terms with positive and negative normalized enrichment scores (NES) were enriched among genes upregulated in TS-derived and primary cells, respectively. (C) GSEA comparison between EVT and TS-derived EVT-like cells. Genes associated with DNA replication were downregulated in TS-derived EVT-like cells. (D) Gene expression patterns at the CYP19A1, EDNRB, IL2RB, and PTN loci. The placenta-specific promoters of these genes were active in ST(3D)-TS CT and ST(3D)-TS blast cells. CYP19A1 has at least 10 promoters and only the placenta-specific promoter is shown. The vertical axis indicates the number of uniquely mapped reads. (E) Sashimi plots of the alternative splicing events of FGFR2. The numbers of reads spanning exon-exon junctions are indicated. Of the two major isoforms of FGFR2 (FGFR2b and FGFR2c), FGFR2b was almost exclusively expressed in CT, TS CT, and TS blast cells. 6

12

13 Figure S5. Related to Figure 5 (A) Density scatterplots of gene body methylation levels and gene expression levels in CT, TS CT, and TS blast cells. Only autosomal genes longer than 5 kb were analyzed. Most repressed regions (FPKM <1) had intermediate methylation levels (30-60%) in CT cells. However, a substantial number of repressed regions were hypomethylated (<20%) in TS CT and TS blast cells. (B) DNA methylation levels of the DSCR4, ELF5, and ZNF750 promoters in all TS lines derived in this study. The DNA methylation levels were analyzed by combined bisulfite restriction analysis (COBRA). Cord blood cells were analyzed for comparison. (C) DNA methylation levels of placenta-specific gdmrs in TS CT and TS blast cells. WGBS data of CT, TS CT, TS blast, human ES, and cord blood cells were analyzed. All of the gdmrs maintained 30-70% methylation levels in TS blast cells except for the ZC3H12C DMR. Publicly available data are used for CT cells (Hamada et al., 2016), human ES cells (Lister et al., 2011) and cord blood cells (Okae et al., 2014). (D) Allelic expression patterns of ZFAT, KLHDC10, PROSER2-AS1, and AIM1. The proportion of maternal and paternal reads is shown. The allelic expression data for CT cells were obtained in our previous study (Hamada et al., 2016). NA, not analyzed due to the lack of informative SNPs. (E) Scatter plots for comparison of expression levels of X-linked genes. The expression levels are shown as log 2 (FPKM + 1). The expression levels of X-linked genes were comparable between male and female TS cells, and XIST (shown in red) was expressed only in female TS cells. (F) Heat map representation of Pearson correlation coefficients for mirna. Publicly available data were used for human ES cells (GEO: GSM438362) and IMR90 cells (GEO: GSM438364). Autosomal mirnas detected in at least one sample (n = 819) were analyzed. 7

14 Table S2. Culture Conditions Tested for the Derivation of Proliferative CT Cells, Related to Figure 1 Reagents Y27632 CHIR99021 A83-01 SB VPA TSA SAHA EGF FGF10 HGF NOG Outcome Note 5 mm 2 mm 0.5 mm 1 mm 0.8 mm ng/ml 50 ng/ml 50 ng/ml 20 ng/ml +++ Condition-1 in Fig. 1B 5 mm mm 1 mm 0.8 mm ng/ml 50 ng/ml 50 ng/ml 20 ng/ml ND Condition-2 in Fig. 1B 5 mm 2 mm 0.5 mm 1 mm 0.8 mm ng/ml 50 ng/ml 20 ng/ml + Condition-3 in Fig. 1B 5 mm 2 mm mm ng/ml 50 ng/ml 50 ng/ml 20 ng/ml + Condition-4 in Fig. 1B 5 mm 2 mm 0.5 mm 1 mm ng/ml 50 ng/ml 50 ng/ml 20 ng/ml + Condition-5 in Fig. 1B - 2 mm 0.5 mm 1 mm 0.8 mm ng/ml 50 ng/ml 50 ng/ml 20 ng/ml ND Condition-6 in Fig. 1B 5 mm 2 mm 0.5 mm 1 mm 0.8 mm ng/ml - 50 ng/ml 20 ng/ml +++ Condition-7 in Fig. 1B 5 mm 2 mm 0.5 mm 1 mm 0.8 mm ng/ml 50 ng/ml - 20 ng/ml +++ Condition-8 in Fig. 1B 5 mm 2 mm 0.5 mm 1 mm 0.8 mm ng/ml 50 ng/ml 50 ng/ml Condition-9 in Fig. 1B 5 mm 2 mm mm ng/ml 50 ng/ml 20 ng/ml ND 5 mm mm 1 mm 0.8 mm ng/ml 50 ng/ml 20 ng/ml ND 5 mm 2 mm 0.5 mm 1 mm 0.8 mm ng/ml TS medium 5 mm 2 mm 0.5 mm mm ng/ml Fig. S1H 5 mm 2 mm - 1 mm 0.8 mm ng/ml mm 2 mm - 10 mm 0.8 mm ng/ml Fig. S1H 5 mm 2 mm 0.5 mm 1 mm - 10 nm - 50 ng/ml Fig. S1G 5 mm 2 mm 0.5 mm 1 mm nm 50 ng/ml Fig. S1G - 2 mm ng/ml ND 5 mm 2 mm ng/ml ND +++, doubling time of hours; ++, doubling time of hours, + doubling time of >36 hours; ND, not derived.

15 Table S3. Summary of TS CT and TS blast Cell Derivation, Related to Figures 1 and 3 TS line Source (Gestational age) Karyotype (Passage number) Doubling time (Passage number) TS CT #1 CT cells (6 weeks) 46, XX (P30) 24.0±1.7 hours (P13) TS CT #2 CT cells (7 weeks) 46, XY (P30) 23.2±3.9 hours (P17) TS CT #3 CT cells (7 weeks) 46, XX (P30) 19.4±1.6 hours (P17) TS CT #4 CT cells (7 weeks) 46, XX (P30) NA TS CT #5 CT cells (7 weeks) 46, XY (P13) NA TS CT #6 CT cells (9 weeks) NA NA TS CT #7 CT cells (6 weeks) NA NA TS CT #8 CT cells (8 weeks) NA NA TS blast #1 Blastocyst 46, XY (P30) 21.7±3.0 hours (P18) TS blast #2 Blastocyst 46, XX (P30) 22.6±2.5 hours (P11) TS blast #3 Blastocyst 46, XY (P13) 23.7±2.6 hours (P11) TS blast #4 Blastocyst 46, XY (P14) NA TS blast #5 Blastocyst 46, XY (P15) NA TS blast #6 Blastocyst 46, XX (P12) NA TS blast #7 Blastocyst NA NA TS blast #8 Blastocyst NA NA Karyotype and population doubling time were analyzed at the indicated passage numbers. NA, not analyzed.

16 Methods S1. Primer Sequences, Related to STAR Methods Description Forward Reverse DSCR4_COBRA TTTGTGGAGAGGAGAAGTTGAGG CCATCTTCTCTTTTTACCACCCATA ELF5_COBRA TGGGGAAAGGAATTTAGTTAGGG TCCATCTCCAACTCCAAAACC ZNF750_COBRA TGGGAGGGATTTAAGTGTAGGA CCACAAATCCTCAAAAACCTCA CGB_real-time CAGCATCCTATCACCTCCTGGT CTGGAACATCTCCATCCTTGGT SDC1_real-time CTATTCCCACGTCTCCAGAACC GGACTACAGCCTCTCCCTCCTT CSH1/2_real-time CATGACTCCCAGACCTCCTTCT ATTTCTGTTGCGTTTCCTCCAT TP63_real-time AGAAACGAAGATCCCCAGATGA CTGTTGCTGTTGCCTGTACGTT TEAD4_real-time CAGGTGGTGGAGAAAGTTGAGA GTGCTTGAGCTTGTGGATGAAG HLA-G_real-time CCACCACCCTGTCTTTGACTAT ACGTCCTGGGTCTGGTCCT MMP2_real-time TGGCACCCATTTACACCTACAC ATGTCAGGAGAGGCCCCATAGA GAPDH_real-time CCTCAACGACCACTTTGTCAAG TCTTCCTCTTGTGCTCTTGCTG