The Obesity Susceptibility Gene Carboxypeptidase E Links FoxO1 Signaling in Hypothalamic Pro opiomelanocortin Neurons with Regulation of Food Intake
|
|
|
- Augusta Hancock
- 5 years ago
- Views:
Transcription
1 Plum et al., Supplementary online material The Oesity Suseptiility Gene Caroxypeptidase E Links FoxO1 Signaling in Hypothalami Pro opiomelanoortin Neurons with Regulation of Food Intake Leona Plum, Hua V. Lin, Roxanne Dutia, Jun Tanaka, Kumiko S. Aizawa, Mihihiro Matsumoto, Andrea J. Kim, Niamh X. Cawley, Ji Hye Paik, Y. Peng Loh, Ronald A. DePinho, Sharon L. Wardlaw and Domenio Aili SI Guide Six Supplementary Figures One Supplementary Tale
2 Plum et al., Supplementary online material Supplementary Figure Legends Supplementary Figure 1 POMC neuron-speifi FoxO1 alation. (a) Representative hypothalami GFP immunohistohemistry in Cre-Gt(ROSA)26Sor tm2sho mie. 3V: third ventrile. () Foxo1 and Cre genotyping. Arrows indiate loxp-flanked (flox, lower arrow) and reomined (, upper arrow) Foxo1 alleles. Pi: pituitary; Hy: medioasal hypothalamus; Bs: rainstem; Cx: ortex; C: ereellum; Li: liver; Pa: panreas; Wa: white adipoyte; Ba: rown adipoyte; Sm: skeletal musle; Co: ontrol. () Relative pituitary Foxo1 expression in adult mie (n = 6). (d) MBH and Agrp promoter ChIP. (e) Relative expression in pituitary of mie in (). (f) Serum ortiosterone levels in adult mie in the asal state and after 1-h restraint stress (females only) (n = 6). Data are presented as means ± SEM. = P <5; = P 1 y t-test. Supplementary Figure 2 Body length and ody mass index. (a) Body mass index (BMI) of NCD fed, 18-week-old female (n = 4 71) and () male (n = 35 67) mie. (, d) Naso-anal ody length of mie in (a, ). Data are presented as means ± SEM. = P 1; = P 1 y unpaired t-test. Supplementary Figure 3 Energy expenditure and food intake. (a) Energy expenditure, plotted as 1-h running averages, () average energy expenditure during the light/day and dark/night phase, () total loomotion in the age periphery, (d) respiratory quotient (RQ), and (e) perentage of NCD ingested during the light (light grey) and dark (dark grey) phase in adult male mie (n = 8).
3 Plum et al., Supplementary online material Supplementary Figure 4 POMC neuron ounts and neuropeptide mrna levels. (a) POMC neuron numers in 15-week-old male mie (n = 9). () Ad liitum (n = 5) and () refed (n = 14 17) MBH mrna expression in 18 week old male mie. Data represent mean ± SEM and are normalized y At levels. = P <5 y t-test. Supplementary Figure 5 MBH neuropeptide mrna and peptide expression. (a) levels in 3 to 4 week old mie (n = 4 6) and () in 4 to 5 week-old (n = 3 4) refed mie. () Agrp and in ad liitum-fed (n = 5) and (d) refed (n = 14 17) 18 week old male mie. (e, f) Agrp/ ratios in the animals shown in (, d). Data represent mean ± SEM. mrna levels (ut not ratios) are normalized y average neuron numer in eah genotype. = P <5 y unpaired t-test. Supplementary Figure 6 Psk2 expression and ghrelin levels. (a) MBH Psk2 in refed male mie (n = 14 15). Data are normalized y At levels. () Western lot of the 64 66kDa P2 isoform in MBH extrats of refed male mie. Atin was used as loading ontrol. () Serum ghrelin levels in adult male mie. Samples were otained one hour efore lights off (n = 7). Data are presented as means ± SEM.
4 a pi hy s x li pa wa a sm o Foxo1 flox Cre IP IgG 1..8 FoxO1 input.6.4 Agrp.2 f KO KO -Foxo1 / Pituitary mrna (aritrary units) e d Cortiosterone (ng ml 1) Foxo1 mrna (aritrary units) 3V -Foxo1 / KO asal asal stress Plum, Supplementary Figure 1
5 a Body mass index (g per m ) P=.661 Body mass index (g per m ) d 1.85 Body length (m) Body length (m) P= Foxo1 / 1.6 -Foxo1 / Plum, Supplementary Figure 2
6 a Energy expenditure (W per kg) Foxo1 / NIGHT DAY Energy expenditure (W per kg) KO KO Night Day Time (min) Loomotor ativity (ounts) d RQ KO KO KO KO -Foxo1 / Night Day Night Day e Food intake (%) Plum, Supplementary Figure 3
7 a -expressing ARC Cells Foxo1 / P=.949 n=9 n=9 -Foxo1 / 1.6 Relative MBH mrna (aritrary units) Agrp Relative MBH mrna (aritrary units) Agrp Plum. Supplementary Figure 4
8 a mrna (aritrary units) ad liitum mrna (aritrary units) h refed -Foxo1 / mrna per ell (AU) ad liitum Agrp d mrna per ell (AU) h refed Agrp e.25 ad liitum f 25 6 h refed MBH mrna Ratio MBH mrna Ratio Agrp/ Agrp/ Plum, Supplementary Figure 5
9 a 6 h refed Psk2 mrna (AU).8.4 -Foxo1 / -Foxo1 / IB: P2 IB: At 64-66kDa 42kDa Serum ghrelin (ng/ml) P=.6 -Foxo1 / Plum, Supplementary Figure 6
10 Plum et al., Supplementary online material Supplementary Tale 1 Neuropeptide levels in MBH of refed mie Peptide -Foxo1 / ACTH 166 ± ± 14 POMC 22 ± ± 16 EP 555 ± ± 32 MSH 36 ± 2 39 ± 2 AgRP 343 ± ± 18 POMC/ MSH.75 ± 6.66 ± 6 Data are presented as mean fmol/mg protein ± SEM (n = 13 18), P = NS.
Rho-kinase Regulates Energy Balance by Targeting Hypothalamic Leptin Receptor Signaling
Rho-kinase Regulates Energy Balane y Targeting Hypothalami Leptin Reeptor Signaling Hu Huang 1, Dong Kong 1, Kyung Hee Byun 2, Chianping Ye 1, Shuihi Koda 1, Dae Ho Lee 1, Byung-Chul Oh 2, Sam W Lee 3,
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for
a b Pml F/F Prrx1-cre f 1.4 n.s.
a b Pml F/F Prrx1-re X Prrx1-re-Pml F/F Relative CFU-F numbers 2. Prrx1-Cre-PML +/+ n.s. d early passages e f 1.4 n.s. Adsorbane Adsorbane.8.6.4.2.8.6.4.2 1 2 3 4 days in ulture late passages 2 4 6 8 1
Supplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
perk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
Hypothalamic TLR2 triggers sickness behavior via a microglia-neuronal axis
Hypothalamic TLR triggers sickness behavior via a microglia-neuronal axis Sungho Jin, *, Jae Geun Kim,, *, Jeong Woo Park, Marco Koch,, Tamas L. Horvath and Byung Ju Lee Department of Biological Sciences,
Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence
Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay Name FoxO1 forward FoxO1 reverse GK forward GK reverse INS-1 forward INS-1 reverse INS-2 forward INS-2 reverse Glut2 forward Glut2
BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.
Supplementary Figure 1 BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Boxplots show the 25% and 75% quantiles of normalized mrna expression levels
WT;ATTAC-5 ** ** SkM
SUPPLEMENTARY INFORMATION doi:.3/nature a WT;ATTAC- H/H;ATTAC- WT;ATTAC- H/H;ATTAC- 3 weeks months GFP p Inka relative expression 3 SkM Skel. Mus. FKBP- relative expression SkM Skel. Mus. relative expression
Supplementary Figure 1. Implants derived from human embryoid body preparations contain non-cardiac structures. In early studies, infarcted hearts
a Supplementary Figure 1. Implants derived from human emryoid ody preparations ontain non-ardia strutures. In early studies, infarted hearts reeived ell preparations of low ardia purity (
Supplementary Information
Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1
Table 1. Oligonucleotides and RT-PCR conditions. Overview of PCR templates, gene accession number of sequences used as template, product size, annealing temperatures and optimal cycles, cdna and MgCl 2
Supplementary Figure 1
Supplementary Figure 1 Arcuate ChIEF-tdTomato neurons expressed TH These micrographs show that TH-Cre-ChIEF-tdTomato (magenta), expressed by AAV in a TH-Cre mouse, were immunostained with TH (green) in
Hypothalamic Autophagy and Regulation of Energy Balance
Hypothalamic Autophagy and Regulation of Energy Balance Rajat Singh, MD Albert Einstein College of Medicine New York NuGOweek 211 Sept 6-9, 211 Autophagy Evolutionarily conserved cellular recycling program
Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons
High-fat Feeding Promotes Obesity via Insulin Receptor/PI3k- Dependent Inhibition of SF-1 VMH Neurons Tim Klöckener 1,2,3, Simon Hess 2,4, Bengt F. Belgardt 1,2,3, Lars Paeger 2,4, Linda A. W. Verhagen
100 osimertinib. concentration of drugs (nm) Ba/F3 C797S/del19. concentration of drugs (nm) Ba/F3 C797S/T790M/L858R. relative cell vaibility (% of
Ba/F3 del19 Ba/F3 L858R a afatini afatini EGF-816 EGF-816 ty (% of ontrol) relative ell vaiilit elative ell vaiility (% of ontrol) 5 1 1 5 ty (% of ontrol) relative ell vaiilit 5 1 1 Ba/F3 T79M/L858R Ba/F3
Neurophysiology of the Regulation of Food Intake and the Common Reward Pathways of Obesity and Addiction. Laura Gunter
Neurophysiology of the Regulation of Food Intake and the Common Reward Pathways of Obesity and Addiction Laura Gunter The Brain as the Regulatory Center for Appetite The brain is the integration center
Spleen VAT FMO. Nature Immunology: doi: /ni Ki67 DX5 CD27. CD11b 2B4 KLRG1 CD69 NKG2D CXCR3 CD44 NKG2A/C/E CD62L CD103 CD94 CD48.
IFN (% of ells) CD7 Marophages Medium NCR LPS PMA/Ionomyin CD IFN (% of ells) T ells Marophages B ells DX CD9 KLRG NKGD B CDL CD CD CXCR CD9 CD NKGA/C/E NCR Ly9h Ly9G Ly9d Ly9i Ly9/i/h FMO CD7 CD9a CD7
ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.
Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water
% of Nestin-EGFP (+) cells
8 7 6 3 Nestin CD % of Nestin-EGFP (+) ells 8 6 Nestin-EGFP Marge Nestin-EGFP Marge Expression levels of Expression levels of Tumorigeniity y stemness markers ifferentiation markers limiting ilution assay
Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed
Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
Table S1. qpcr primer list.
Table S1. qpr primer list. Genes Forward primer Reverse primer NANOG AAATGGGAAGAATAGA GGTTAGTGGGTTA PAX6 TTTTGTTGGGAAATG TGGTTAAATTTAG ASL1 AAGATGAAAGAAAG GGAGTTTGATTAA NHLH GTGGATAGATATTT ATATTTTGGAATTT
SUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
Supplementary Fig. 1: TBR2+ cells in different brain regions.
Hip SVZ OB Cere Hypo Supplementary Fig. 1: TBR2 + cells in different brain regions. Three weeks after the last tamoxifen injection, TBR2 immunostaining images reveal a large reduction of TBR2 + cells in
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
Supplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
SUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,
Critical role for peptide YY in protein-mediated satiation and bodyweight
Cell Metabolism, Volume 4 Supplemental data Critical role for peptide YY in protein-mediated satiation and bodyweight regulation Rachel L. Batterham, Helen Heffron, Saloni Kapoor, Joanna E. Chivers, Keval
Supplemental Information. The Hormone FGF21 Stimulates Water Drinking. in Response to Ketogenic Diet and Alcohol
ell Metabolism, Volume 7 Supplemental Information The Hormone Stimulates Water Drinking in Response to Ketogenic Diet and lcohol Parkyong Song, hristoph Zechner, Genaro Hernandez, José ánovas, Yang Xie,
Supplementary Figure 1 a OD c. 1. 1... Time [min] 1 p Supplementary Information
Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,
Leptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph
Leptin Intro/Signaling ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Overview Intro to Leptin Definition & Sources Physiology Bound vs. Free Receptors Signaling JAK/STAT MAPK PI3K ACC Experimental findings
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
PI3Ka inactivation in leptin receptor cells increases leptin sensitivity but disrupts growth and reproduction
PI3Ka inactivation in leptin receptor cells increases leptin sensitivity but disrupts growth and reproduction David Garcia-Galiano,, Jennifer W. Hill, Carol F. Elias JCI Insight. 2017;2(23):e96728.. Research
Understanding Obesity Genes and Environment in the Determination of Body Weight Prof. Rudy Leibel
Understanding Obesity Genes and Environment in the Determination of Body Weight R. Leibel Division of Molecular Genetics and Naomi Berrie Diabetes Center Columbia University 1 Why Is Body Weight (Fat Mass)
Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously
Ingestive Behaviors 21. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model)
Ingestive Behaviors 21 (a review of general endocrinology) A neuroendocrine system: components, a reflex arc, the endocrine system, the AN, endocrine / nervous systems as afferents and efferents, the theoretical
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
Learned spatiotemporal sequence recognition and prediction in primary visual cortex
Supplementary Materials for Learned spatiotemporal sequene reognition and predition in primary visual ortex Jeffrey P. Gavornik and Mark F. Bear Howard Hughes Medial Institute Piower Institute for Learning
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
Supplementary Figure 1. mir124 does not change neuron morphology and synaptic
Supplementary Figure 1. mir124 does not change neuron morphology and synaptic density. Hippocampal neurons were transfected with mir124 (containing DsRed) or DsRed as a control. 2 d after transfection,
Cytomegalovirus and tumor stress-surveillance by human γδ T cell receptor binding to Endothelial Protein C Receptor
Cytomegalovirus and tumor stress-surveillane y human γδ T ell reeptor inding to Endothelial Protein C Reeptor Carrie R. Willox, Vinent Pitard, Sonia Netzer, Lionel Couzi, Mahoo Salim, Toias Silerzahn,
SUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
Supplementary Figure 1 Maschalidi et al.
a 1% 5% % 1% 5% % OVAb βgal activity A.U. (x1 4 ) 2 1 5 βgal activity A.U. (x1 4 ) 2 1 BSAb 2 hours 4 hours OVAb BSAb OVAb BSAb,1 1 1 1 SIINFEKL (ng/ml) CFSE b Beads Alexa488 (%) 8 6 4 2 ** ** 1:1 5:1
Insulin-Leptin Interactions
Insulin-Leptin Interactions Ahmed S., Al-Azzam N., Cao B. Karshaleva B., Sriram S., Vu K. If you understand a system, you can predict it. Agenda - Energy homeostasis Overview of leptin and insulin Signaling
1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Supplementary Information
Supplementary Information Supplementary s Supplementary 1 All three types of foods suppress subsequent feeding in both sexes when the same food is used in the pre-feeding test feeding. (a) Adjusted pre-feeding
100 μm. Axon growth cones. Tubulin (red) + scr (green)
Supplementary Figures mirorna-9 regulates axon extension an ranhing y targeting Map1 in mouse ortial neurons Dajas-Bailaor, F., Bonev, B., Garez, P., Stanley, P., Guillemot, F., Papalopulu, N. a 2 μm 1
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and
Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and
SORCS1 and SORCS3 control energy balance and orexigenic peptide production
Article SORCS1 and SORCS3 control energy balance and orexigenic peptide production Aygul Subkhangulova 1,*, Anna R Malik 1, Guido Hermey 2, Oliver Popp 1, Gunnar Dittmar 1,3,, Thomas Rathjen 1, Matthew
CNS Control of Food Intake. Adena Zadourian & Andrea Shelton
CNS Control of Food Intake Adena Zadourian & Andrea Shelton Controlling Food Intake Energy Homeostasis (Change in body adiposity + compensatory changes in food intake) Background Information/Review Insulin
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Supplemental Information. Melanopsin-Encoded Response Properties. of Intrinsically Photosensitive. Retinal Ganglion Cells
Neuron, Volume 90 Supplemental Information Melanopsin-Encoded Response Properties of Intrinsically Photosensitive Retinal Ganglion Cells Ludovic S. Mure, Megumi Hatori, Quansheng Zhu, James Demas, Irene
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Supplementary Information
Supplementary Information Optial ontrolling reveals time-dependent roles for adult-orn dentate granule ells Yan Gu, Maithe Arruda-Carvalho 3,4, Jia Wang, Stephen Janoshka,, Sheena Josselyn 3-5, Paul Frankland
Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
Supplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
SOM Husse et al. Supplementary online material. Synaptotagmin10-Cre, a driver to disrupt clock genes in the SCN
SOM Husse et al. Supplementary online material Synaptotagmin10-Cre, a driver to disrupt clock genes in the SCN Jana Husse, Xunlei Zhou, Anton Shostak, Henrik Oster and Gregor Eichele SOM Husse et al.,
Effect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
Energy flow in the organism
I. Parameters of energy metabolism, basal metabolic rate, measurements. II. Control of food intake, hunger and satiety Péter Sántha, 12.02. 2017. Energy flow in the organism NUTRIENTS PHYSICAL WORK HEAT
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Figure 1: The leptin/melanocortin pathway Neuronal populations propagate the signaling of various molecules (leptin, insulin, ghrelin) to control
Leptin Deficiency Introduction The leptin/melanocortin pathway plays a key role in the hypothalamic control of food intake. It is activated following the systemic release of the adipokine leptin (LEP)
Control 7 d cold 7 d CL
Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with
Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
Activation of calcium signaling through Trpv1 by nnos and peroxynitrite as a key trigger of skeletal muscle hypertrophy
Activation of calcium signaling through Trpv y nnos and peroxynitrite as a key trigger of skeletal muscle hypertrophy Naoki Ito, Urs T. Ruegg, Akira Kudo, Yuko Miyagoe-Suzuki, and Shin ichi Takeda Supplementary
Supplementary Figure S1. TRAIL-induced necroptosis at acidic phe is dependent on
Online supplementary information Supplementary Figure S1. TRAIL-induced necroptos at acidic phe is dependent on RIPK1 and RIPK3. (a) HT29 cells were tranently transfected with RIPK1, RIPK3, RIPK1/ RIPK3
Internal Regulation II Energy
Internal Regulation II Energy Reading: BCP Chapter 16 lookfordiagnosis.com Homeostasis Biologically, what is necessary for life is a coordinated set of chemical reactions. These reactions take place in
Ingestive Behaviors 33. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model)
Ingestive Behaviors 33 (a review of general endocrinology) A neuroendocrine system: components, a reflex arc, the endocrine system, the AN, endocrine / nervous systems as afferents and efferents, the theoretical
SUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
Supplementary Figure 1. Verification of drug infusions into the IPN. a. Representative
Supplementary Figure 1. Verifiation of drug infusions into the IPN. a. Representative neutral red-stained oronal setion from a mouse with a guide annula targeting the IPN. The guide annula sar is irled
Bi156 lecture 2, 1/6/12. Eating and weight regulation
Bi156 lecture 2, 1/6/12 Eating and weight regulation Introduction: weight regulation in an affluent society In our society much effort and money is expended on regulation of weight. Failure to maintain
Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
The central melanocortin system affects the hypothalamopituitary thyroid axis and may mediate the effect of leptin
The central melanocortin system affects the hypothalamopituitary thyroid axis and may mediate the effect of leptin M.S. Kim, C.J. Small, S.A Stanley, D.G.A. Morgan, L.J. Seal, W.M. Kong, C.M.B. Edwards,
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
letters to nature ... AMP-kinase regulates food intake by responding to hormonal and nutrient signals in the hypothalamus
... AMP-kinase regulates food intake by responding to hormonal and nutrient signals in the hypothalamus Yasuhiko Minokoshi 1, Thierry Alquier 1, Noboru Furukawa 1, Young-Bum Kim 1, Anna Lee 1, Bingzhong
Glucocorticoids Exacerbate Obesity and Insulin Resistance in Neuron-Specific Proopiomelanocortin-Deficient Mice
Digital Commons @ George Fox University Faculty Publications - Department of Biology and Chemistry Department of Biology and Chemistry 2-2006 Glucocorticoids Exacerbate Obesity and Insulin Resistance in