Supporting Information

Size: px
Start display at page:

Download "Supporting Information"

Transcription

1 Supporting Information Sun et al..73/pnas.4479 SI Materials and Methods High Fat iet (HF) and oxycycline (ox)-ontaining HF. For all of the HF feeding experiments, mice were fed with a diet containing 6% calories from fat (49; Research iets). The HF paste with 6 mg/kg ox also contains 6% calories from fat (S5867; io-serv). For low-dose ox treatment, the ox powder (Sigma) was mixed with HF paste (Research iets) to a final concentration of 6 mg/kg. Protein Analysis. Tissues were lysed by methods described previously (). The protein concentration was measured by a A assay bit (Pierce). Proteins were then separated with % or 4 % is-tris gels (Invitrogen) and transferred to PVF membranes (Millipore). For immunobloting, the primary antibodies for, β-actin (Santa ruz iotechology), UP- (Aam), PG-α (NOVUS iologicals), and adiponectin () were used followed by secondary antibodies labeled with infared dye emitting at 8 nm (Li-or ioscience). The blots were analyzed by Odyssey software (version.; Li-or ioscience). Serum samples were also analyzed by immunoblotting with the method above. In addition, they were measured with the following adipokine levels with ELISA kits: adiponectin (Millipore), leptin (Millipore), SAA3 (Millipore), and (R&). Liver Lipid ontent. Frozen tissues ( mg) were used for lipid extraction and measurement by the Metabolic ore Facility at the University of Texas Southwestern Medical enter. In brief, -mg pieces were snap frozen in liquid nitrogen until analysis. Lipids were extracted and the chloroform phase was adjusted to 5 ml total volume, and triplicates of 5 ml in combination with standards were dried down by the addition of ml of : chloroform Triton X- mix. Triglyceride (TG) levels were then assayed using Infinity reagent (Thermo Fisher Scientific). Histology. Tissues were excised and fixed in % formalin (PS buffered) for 4 h. Following paraffin embedding, the tissue sections were stained with hematoxylin and eosin (H&E) and Masson s trichrome using standard protocols. For immunohistochemistry, sections were stained with primary antibodies against 3 ( ioscience), receptor (R) and phosphorylated receptor (Y75; ell Signaling), F4/8 (Santa ruz), Mac- (edarlane Laboratories), and perilipin (Affinity ioreagents) and then followed by biotinylated secondary antibodies (antimouse, antirat, and antirabbit) (ako). inding of second antibodies was visualized using A chromogen A (ako) following the company s protocol. ounterstaining was performed with hematoxylin. All of the images were acquired with the oolscope microscopy (Nikon). Quantification of adipocyte areas was done on H&E stained section using ImageJ software (NIH). Indirect alorimetric Measurements. Mice were housed individually in metabolic chambers and maintained on a -h dark light cycle at to with lights on at 7: AM to 7: PM. Metabolic measurements were obtained continuously using LAMS metabolic chambers (LAMS System) in an open circuit indirect calorimetric system. All transgenic mice and their littermate control mice were provided with HF paste containing 6 mg/kg ox and water ad libitum. Quantitative Real-Time PR. Tissues were excised and snap frozen in liquid nitrogen. Total RNA were extracted from tissues in TRIzol (Invitrogen) using a TissueLyser (Qiagen) and then isolated using the RNeasy RNA extraction kit (Qiagen). The quality and quantity of the RNA were determined by absorbance at 6/8 nm. cna was prepared by reverse transcribing μgof RNA with SuperScript III reverse transcriptase and oligo (dt) (Invitrogen). qpr reactions were carried out on an AI Prism 79 HT sequence detection system (Applied iosystems). The primer sequences are listed in Table S. Results were calculated using the threshold cycle method, normalized by β-actin or hypoxanthine phosphoribosyltransferase (HPRT). ody omposition. one-free lean body mass, fat mass, and body fluid composition were measured in nonanesthetized mice using an Echo3-in- NMR (MRI) machine mini Spec (ruker). Systemic Metabolic Tests and lood hemistry. For the oral glucose tolerance tests (OGTTs), mice were fasted for 3 h before administration of glucose (.5 g/kg body weight) by gastric gavage. At the indicated time points, tail venous blood samples were collected in heparin-coated capillary tubes. Glucose levels were measured using an oxidase-peroxidase assay (Sigma-Aldrich). Mice did not have access to food throughout the experiment. For insulin tolerance tests (ITTs), mice were fasted for 3 h before i.p injection of insulin (Sigma) at mu/kg body weight. At the indicated time points, tail venous blood samples were collected for glucose level analysis. For lipid clearance assay, mice were fasted for 3 h and then gavaged with % Intralipid (axter Healthcare). At the indicated time points, tail venous blood samples were collected. Serum TG levels (Infinity; Thermo Fisher Scientific) and free fatty acid (FFA) levels (NEFA-HR) () (Wako Pure hemical Industries) were assayed following a 3-h fast. In Vivo Hypoxia etection. The mice were injected (i.p.) a Hypoxyprobe- solution (Hypoxyprobe) at a dose of 6 mg/kg body weight. Ten minutes later, the mice were anesthetized and the tissues were fixed in % formalin PS for 4 h. The detection of Hypoxyprobe- was by a Hypoxyprobe- Plus kit (Hypoxyprobe) following the supplier s protocol. Lectin-Labeling, Immunofluorescent Staining, and Imaging of AT Vasculature. Functional blood vessels were labeled in mice by injecting with. ml of mg/ml rhodamine (for HF-fed mice) or biotinylated (for ob/ob mice) Griffonia (andeiraea) simplicifolia lectin I (Vector Laboratories) ( μg/i.v. injection per mouse) through the tail vein. The injected lectin was allowed to circulate for 3 min before the animal was perfused through the left ventricle with % paraformaldehyde. AT and liver were then excised and fixed in % PS-buffered formalin overnight and then embedded in paraffin and cut into 5-μm sections. The lectin was visualized directly (with rhodamine) or using a y3-labeled streptavidin (Vector Labs), whereas nuclei were stained with API (4,6-diamidino--phenylindole) (Sigma-Aldrich). Tissue sections were mounted on slides using Vectashield mounting media for fluorescence (Vector Labs). Lectin-stained capillaries were visualized by either confocal (Leica TS SP5 cofocal microscope) or epifluorescence microscopy (Zeiss AxioObserver wide-field epifluorescence microscope).. Halberg N, et al. (9) Hypoxia-inducible factor alpha induces fibrosis and insulin resistance in white adipose tissue. Mol ell iol 9: Halberg N, et al. (9) Systemic fate of the adipocyte-derived factor adiponectin. iabetes 58: Sun et al. of8

2 Adiponec n Promoter rtta α--a +OX rtta teto promoter AT Liver wt Apn-rtTA -OX TRE- Apn-rtTA XTRE- wt Apn-rtTA +OX TRE- Apn-rtTA XTRE- α ng/ml Serum ( ELISA) HPRT Fig. S. haracterization of AT-specific ox-inducible -A Tg mice. (A) Schematic representative of adiponectin promoter-driven ox-inducible -A transgenic mice. The ox-dependent promoter driven -A is regulated by rtta, whose expression is under the control of adiponectin promoter. -A in the double transgenic mouse is induced in the presence of ox. () q-pr analysis with the transgenic-specific primers showed that ox induces the expression of the transgene only in Apn rtta and TRE -A double transgenic mice. The readings were normalized to hypoxanthine phosphoribosyltransferase. () Western blot analysis of -A levels with α- in different fat pads and liver in -Tg or littermate control mice after ox induction for 9wk(n = per group). () Serum -A levels in -A Tg and control mice tested by an ELISA kit (n = 4 in control; n = 5 in Tg). A gram w % ody Weight (wks) Fat Mass control transgenic ody Fluid ITT (Glucose) control transgenic (Mins) AT mg/dl mg/dl Fas ng Glucose Fas ng Insulin ng/ml.5 Fig. S. -A Tg mice exhibit higher density of vasculature and improved metabolic profile. (A) ody weight changes and MRI analysis of bone-free body compositions in Tg and littermate control mice after HF plus ox treated for 6 wk. (n = 5 per group). P <.5. () omparison of different fat pads from Tg mice and control littermates after ox treatment for 8 wk. The WAT in -A treated mice showed highly dense vasculature. () Glucose levels in an insulin tolerance test (ITT) with Tg and their littermate control group (n = 5 per group). P <.5; P <.. () Fasting glucose and insulin levels in Tg and their littermate control groups. The mice were fasted for h before the tail blood was collected after HF plus ox treatment for 8 wk (n = 5 per group). P <.. Sun et al. of8

3 mg/dl Lipid learance (Hrs) Serum NEFA mg/g meq/ug Liver holesterol Liver NEFA mg/g Liver TG meq/l.5 Tg E Rela ve value LPL(q-PR ) LPL(q-PR heart) 4 Rela ve value Fig. S3. -A Tg mice have increased lipid clearance and decreased HF-induced hepatic steatosis. (A) Serum triglyceride levels measured in a lipid clearance test on -A Tg and control littermates after HF plus ox treatment for 8 wk. The differences at all of the time points are significant by Student s t test with P <.. () Serum NEFA in Tg and control littermates after HF plus ox treatment for 8 wk (n = 4 in control; n = 5 in -A Tg). P <.. () Liver cholesterol, triglyceride, and NEFA in -A Tg and their control littermates after HF plus ox treatment for 8 wk (n = 4 in control; n =5in -A Tg). P <.5; P <.. () H&E staining of the liver tissue in -A Tg and control littermates. (Left) HF-treated liver have more and bigger lipid droplets than (Right) -A Tg liver. (E) q-pr analysis of lipoprotein lipase (LPL) in Tg mice and their littermate controls (n = 4 in each group) in (Left) and heart tissue (Right). The readings were normalized with the HPRT gene. P <.5; P <.. Sun et al. 3of8

4 5 Fat Size 3 Fat Size Area (μm ) 5 PPARγ (q-pr) ZFP43 (q-pr) rela ve value PGα (Quan fica on for W).7 fold 6 fold UP (Quan fica on for W) 6.fold 34.8 fold Fig. S4. Local overexpression of -A in AT decreases adipocyte size and enhances a AT-like phenotype in WAT. (A) Quantitative measurement of the fat size in Tg and their littermate control groups after HF plus ox treatment for 8 wk (H&E staining is shown in Fig. 3A). P <.. () q-pr analysis of adipogenic genes PPARγ and ZFP43 in Tg mice and their littermate controls. The readings were normalized with HPRT gene (n = 4 in control, n =5in Tg). () Quantitative measurements of the immunobloting bands for PG-α and UP- in Fig. 3 by ImageJ software from NIH. Sun et al. 4of8

5 rela ve value rela ve value Lep n (q-pr ) Apn (QPR ) Serum Levels ng/ml Lep n (Serum ELISA) α-adiponec n Tissue Lysates AT Liver AT Liver α-adiponec n 5 serum AT Fig. S5. -A Tg mice have lower serum leptin and adiponectin levels. (A) q-pr analysis of leptin mrna levels in of Tg and their littermate control mice after HF plus ox treatment for 8 wk (Left). P <.5; and ELISA analysis of circulating leptin levels in both groups (n = 4 in control; n = 5 in Tg, Right). P <.. () q-pr analysis of adiponectin mrna levels in in Tg and their littermate groups (n = 4 in control; n = 5 in Tg). () Western blot analysis for serum adiponectin levels (Upper) and tissue levels (Lower) with α-adiponectin (n = 4 for control, n = 5 for Tg) after HF plus ox treatment for 8 wk. () Quantitative measurements of the bands in with ImageJ software. P <.. Sun et al. 5of8

6 SAA3 (ELISA) Trichrome staining 5 Quan fica on of crown-like structures in WAT % 5 Fig. S6. -A Tg mice decreases the abnormal EM development and local inflammation in WAT. (A) irculating SAA3 levels analyzed by ELISA in -A Tg and their littermate controls after HF plus ox treatment for 8 wk (n = 4 in control; n = 5 in Tg). P <.5. () Trichrome staining of WAT in -A Tg mice and littermate controls. The positive staining (blue color) is indicated by the arrows in the control HF-fed mice. () Quantitative measurements of the numbers of crowns for Fig. 4 and for fat pads (image data not shown). A 35 IgG ody Weight IgG IgG g Relative value (ays) (q-pr) IgG IgG p=.5 5 Quan fica on of the W p=.6 IH with an -Mac IgG IgG IgG An -Apn AT IWAT Liver Fig. S7. lockade of angiogenesis during early stage of fat expansion impairs adiponectin secretion. (A) ody weight changes during and control IgG treatment under HF challenge (n = 5 per group). () q-pr analysis of 3 in fat tissues and liver (n = 4 per group). () Western blot analysis of the serum from - and control IgG-treated groups with antiadiponectin (Upper, n = 4 in control; n = 5 in Tg) and quantitative measurements of the immunoblot band density by ImageJ software (Lower). () Histoimmunochemical staining of Mac, a macrophage marker in in and control IgG mice after antibody treatment for 7 wk. Red arrows indicate the crown-like structures. Sun et al. 6of8

7 5 ob/ob mice ody weight.5 3 (q-pr) 45. g IgG Rela ve Value. 3 4 wks.5. IgG IgG Fig. S8. blocks 3 levels in ob/ob mice. (A) ody weight change in ob/ob mice treated with or control IgG via i.p. injection. The -treated mice gained less body weight starting from the second week of treatment. () q-pr analysis of 3 levels in WAT of - and control IgG-treated mice (n = 5 per group). (mg/dl) Lec n staining IgG OGTT (glucose) IgG mins Rela ve values F4/8 MP- IH with an -perilipin IgG mg/dl Glucose p=.5 mmol/l Serum FFA Fig. S9. treatment enhances insulin sensitivity to improve the metabolic phenotype in ob/ob mice. (A) Functional blood vessels in AT labeled by biotinylated lectin- in mice treated with or control IgG for 3 wk. lood vessels are shown in red, the nuclei in blue, by API staining. () Glucose levels in an OGTT in mice treated with or control IgG for 3 wk. () Fasting glucose and serum FFA levels in - or control IgG-treated mice. Mice were fasted for h before serum glucose and FFA levels analyzed (n = 5 per group). P <.5. () q-pr analysis of inflammatory factor MP- and macrophage marker F4/8 (n = 5 per group). P <.5. (E) Immunohistochemical analysis of perilipin in of - and control IgG-treated mice. Sun et al. 7of8

8 Table S. Gene name Primers for q-prs Sequences -A 3 R olα ol3α ol6α HIFα LOX F4/8+ MP- TNF-α IL-6 β-actin Nur77 PPARγ Pref- ZFP43 SAA3 FOXO HPRT F 5 -GGAGATTTGAGGAGATT-3 ; R5 -GGGATTTAGAGAGATATAAGAA-3 F 5 -ATGAAGAAATTAA-3 ; R5 -GAAGGATGGAAATAAAA-3 F 5 -TGTATATGTTT-3 ; R5 -AAGGAATATGTTG-3 F 5 -GTGTTGGTATTGTGGT-3 ; R5 -AAGGAATATGTTG-3 F 5 -GGGTTTTGGTTAAAg-3 ; R5 -TGGTTTATTTTT-3 F 5 -GATGAGGGTGAAGTGGGAGA-3 ; R5 -AGAGAAGAGGATGTAA-3 F5 -AAGATTGGGAAGAA-3 ; R5 -GGTGAGTATAAAGAAGTTT-3 F 5 -AAGATGGAGAATTA-3 ; R5 -AGTTGTTTGTGGTTA-3 F 5 -TTTGGTATGGGTTAGT-3 ; R5 -GAAGGAGGAAGAGTTTATGTG-3 F 5 - AGAAGAATTA-3 ; R5 - TTGGAATTTTTTG-3 F5 -GAGAAAGTAATTTTG-3 ; R5 - GAAGATTAGGTATATG-3 F 5 - AGAGATAAAAGAAATGATGG-3 ; R5 - ATAGAAGAAGAGGAAAT-3 F 5 -TAAAGGATTGTGATGG-3 ; R5 -TTTGATGTAGAGATTT-3 F 5 -GTTGGAATTGAA-3 ; R5 -ATAGTGTGAAGAAGATTGT-3 F5 -TGAGGAGAGAGAAAG-3 ; R5 -GAGAGAGTATTGGTATT-3 F 5 -AGTGATTGAAGGATGGTG-3 ; R5 -TTGTGTGGAGTTTTAG-3 F 5 -GAGAGAGAGAAGTGAG-3 ; R5 -GAATAGTGGAGAGGA-3 F 5 -TGGGTGTGTAAAGTAT-3 ; R5 -AAGTAGTTGTTT-3 F 5 -GAGTGAGAATGAAGGAATG-3 ; R5 -TTAGAAAATGAGAAGGGTG-3 F 5 -AGAGTAAGAAAA-3 ; R5 -TTTGGTTTTAGTTTA-3 Sun et al. 8of8

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week

More information

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency AdPLA AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency Kathy Jaworski, Maryam Ahmadian, Robin E. Duncan, Eszter Sarkadi-Nagy, Krista A. Va rady,

More information

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

The murine Resistin coding sequence was amplified from a fetal mouse cdna library and cloned

The murine Resistin coding sequence was amplified from a fetal mouse cdna library and cloned ESM METHODS Generation of Resistin transgenic mice The murine Resistin coding sequence was amplified from a fetal mouse cdna library and cloned into pcr4ta (Invitrogen). This was subcloned into a transgenic

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Supporting Information

Supporting Information Supporting Information Herrero et al..73/pnas.9537 SI Materials and Methods Mice ap2-nsrp-c transgenic males (strain 3393, 57L/6J x SJL) were purchased from Jackson Laboratories and crossed to P8, using

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Supporting Information

Supporting Information Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

More information

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according

More information

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Supplemental Information

Supplemental Information Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total

More information

Supporting Information

Supporting Information Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp, SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte

More information

Supporting Information

Supporting Information Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs

More information

Pair-fed % inkt cells 0.5. EtOH 0.0

Pair-fed % inkt cells 0.5. EtOH 0.0 MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

Supporting Information

Supporting Information Supporting Information Shime et al. 1.173/pnas.11139919 SI Methods Reagents. was purchased from GE Healthcare, which was free from LPS contamination. TNF-α and IFN-β ELISA kit was purchased from eioscience

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:

More information

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence

More information

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels

More information

Supporting Information Table of content

Supporting Information Table of content Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting

More information

Spheroid-based engineering of a human vasculature in mice

Spheroid-based engineering of a human vasculature in mice Spheroid-based engineering of a human vasculature in mice Abdullah Alajati, Anna M. Laib, Holger Weber, Anja M. Boos, Arne Bartol, Kristian Ikenberg, Thomas Korff, Hanswalter Zentgraf, Cynthia Obodozie,

More information

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed

More information

Control 7 d cold 7 d CL

Control 7 d cold 7 d CL Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Visualization of endoplasmic reticulum-mitochondria interaction by in situ proximity ligation assay. A) Illustration of targeted proteins in mitochondria (M), endoplasmic reticulum

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/389/ra79/dc1 Supplementary Materials for HDL-bound sphingosine 1-phosphate acts as a biased agonist for the endothelial cell receptor S1P 1 to limit vascular

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR

More information

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA

More information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8 Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory

More information

Naohito AOKI, Erina ARAKAWA and Miyuki ITO. Department of Life Science, Graduate School of Bioresources, Mie University Tsu ABSTRACT

Naohito AOKI, Erina ARAKAWA and Miyuki ITO. Department of Life Science, Graduate School of Bioresources, Mie University Tsu ABSTRACT Naohito AOKI, Erina ARAKAWA and Miyuki ITO Department of Life Science, Graduate School of Bioresources, Mie University Tsu 514-857 ABSTRACT C57BL/6J mice (male, 4wk old) were fed low fat diet (LF), high

More information

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko

More information

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)

More information

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation. SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic

More information

Protein extraction and western blot analysis Protein extraction was performed as

Protein extraction and western blot analysis Protein extraction was performed as ESM Methods Protein extraction and western blot analysis Protein extraction was performed as previously described [1]. 2 g protein was loaded on SDSPAGE and immunoblotted with antibodies to mouse AKT (1:1,

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao

More information

Obesity-associated improvements in metabolic profile through expansion of adipose tissue

Obesity-associated improvements in metabolic profile through expansion of adipose tissue JCI Online First. Published online on August 24, 2007. Research article Obesity-associated improvements in metabolic profile through expansion of adipose tissue Ja-Young Kim, 1 Esther van de Wall, 2 Mathieu

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.

Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Pancreata from 16-weeks-old 6J +/+, 6J db/db, KS +/+ and KS db/db mice were harvested, fixed with

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

Lipoprotein Lipase Activity Assay Kit (Fluorometric)

Lipoprotein Lipase Activity Assay Kit (Fluorometric) Lipoprotein Lipase Activity Assay Kit (Fluorometric) Catalog Number KA4538 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General

More information

Cells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2],

Cells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2], Supplementary information Methods Cells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2], and A/Hong Kong/213/03 [H5N1]) were grown in Madin-Darby canine kidney (MDCK) cells

More information

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC Published in "" which should be cited to refer to this work. mrna extraction and RT-PCR Total RNA from 5 15 mg of crushed white adipose tissue was isolated using the technique described by Chomczynski

More information

Supporting Information

Supporting Information Supporting Information Kayama et al. 1.173/pnas.11193119 SI Materials and Methods Reagents. 1-methyl-L-tryptophan and nordihydroguaiaretic acid were purchased from Sigma Aldrich. N W -hydroxyl-nor-l-arginine,

More information

Supporting Information

Supporting Information Supporting Information Fujishita et al. 10.1073/pnas.0800041105 SI Text Polyp Scoring. Intestinal polyps were counted as described (1). Briefly, the small and large intestines were excised, washed with

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

Lipid (Oil Red O) staining Kit

Lipid (Oil Red O) staining Kit Lipid (Oil Red O) staining Kit Catalog Number KA4541 1 Kit Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials

More information

Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes

Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014 Outline I. Introduction II. Research route & Results III. Summary Diabetes the Epidemic of the 21st Century

More information

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla

More information

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171 SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)

More information

LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:!

LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:! LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:! Spinal cord and peripheral nerves! Eyes, Inner ear, nasal

More information

Expanded View Figures

Expanded View Figures Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and

More information

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells 1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)

More information

PPARγ in the endothelium regulates metabolic responses to high-fat diet in mice

PPARγ in the endothelium regulates metabolic responses to high-fat diet in mice Research article PPARγ in the endothelium regulates metabolic responses to high-fat diet in mice Takeshi Kanda, 1 Jonathan D. Brown, 1 Gabriela Orasanu, 1 Silke Vogel, 2 Frank J. Gonzalez, 3 Juliano Sartoretto,

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

Supplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature

Supplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature Cell Reports, Volume 18 Supplemental Information Tissue Myeloid Progenitors Differentiate into Pericytes through TGF-b Signaling in Developing Skin Vasculature Tomoko Yamazaki, Ani Nalbandian, Yutaka Uchida,

More information