Figure 1. Dnmt3b expression in murine and human knee joint cartilage. (A) Representative images
|
|
- Joshua Robert Shelton
- 5 years ago
- Views:
Transcription
1 Figure Legends Figure. expression in murine and human knee joint cartilage. () Representative images showing that Dnmta is not expressed in chondrocytes from mo W articular cartilage [Dnmta expression in pancreas tissue (positive control)], while robust expression of in chondrocytes of mo W articular cartilage and lower expression in underlying growth plate cartilage (n=); the magnified images of the dashed and solid boxed area of articular cartilage in separate panels; () Representative images showing expression in mo (n=) versus 7 mo (n=) W murine knee articular cartilage; () Representative images showing expression in wk old murine articular cartilage following MLI surgery (n=) or cartilage from sham control knees (n=); (D) Representative images showing expression in wk old murine articular cartilage in mice fed a high fat diet (HFD) (n=) or controls (trl) fed a normal diet (n=). (E) wo representative images showing DNM expression in human healthy articular cartilage (n=) or osteoarthritic cartilage tissue sections (n=7). (F) Reduced DNM expression in human primary O chondrocytes compared to healthy chondrocytes (n=). () Induction of human primary chondrocytes (n = ) with IL-β results in decreased expression of DNM mrn and protein levels. ll scale bars, µm. Figure S. expression in embryonic and adult murine knee joint cartilage. Immunohistochemical staining shows protein expression in chondrocytes from 57L/ W murine articular cartilage knee joints at embryonic time point E8.5 and post-natal time points P7, P8 and P5 (n=)., hypertrophic chondrocyte;, bone marrow cells. ll scale bars, µm. Figure S. ltered anabolic and catabolic gene expression in IL-β-treated human primary chondrocytes. Reduced OL and increased MMP expression following IL-β treatment (8 h) of human primary articular chondrocytes isolated from total knee replacement surgeries (n=). Figure S. IL-β regulation of is mediated in part by NF-κ. () Sequence alignment and conservation of an NF-κ binding site (red) in the promoter region of the gene of different 8
2 species. () Reduced luciferase expression in IL-β stimulated ( h) chondrogenic murine D-5 cells transfected with a luciferase reporter plasmid containing the promoter sequence when compared to control (trl) untreated cells. Reduced luciferase activity is attenuated when D-5 cells were transfected with a reporter plasmid containing a mutated NF-κ binding site () (n=). (, D) Pull-down of genomic DN with an NF-κ antibody (hip assay) shows interaction of NF-κ with its binding site in the promoter region by qpr () and semi-quantitative gel electrophoresis (D) utilizing specific primers to amplify the promoter region containing the NF-κ binding site (n=). (E, F) mrn and protein levels were reduced in murine W primary articular chondrocytes (extracted from mo murine knee joints) following IL-β induction (8 h) (n=). Figure S. blation of in articular chondrocytes in vitro alters cell homeostasis. Reduced expression of () mrn and () protein following transfection with nm sirn for 8 h in murine primary chondrocytes isolated from mo W mice (n=). () sirn treatment resulted in increased expression of the catabolic/hypertrophic chondrocyte markers ola, Runx, and Mmp, and decreased expression of the anabolic marker, ola in murine primary chondrocytes (n=). (D) Representative images showing reduced expression resulted in increased alkaline phosphatase (LP) activity in murine primary chondrocytes, but not to the extent resulting from MP- treatment (positive control) (n=). (E, F) sirn treatment affected the balance of F-β and MP signaling as shown by decreased phospho(p)-smad expression and increased p-smad/5 expression in murine primary chondrocytes, respectively (n=). Figure. loss-of-function mice develop accelerated O. () Representative alcian blue / hematoxylin / orange (H/O) staining of tissue sections of knee joints harvested from 5 mo and 8 mo loss-of-function () mice and re + control (trl) mice (n=5). he magnified images of the boxed regions are shown respectively. () ORSI scoring system was used to quantify the H/O stained tissue sections (n=5). () rticular cartilage area was quantified by histomorphometry (n=5). (D) 9
3 Representative micro images of knee joints from 8 mo and trl mice (n=5). (E) Subchondral bone volume and (F) subchondral bone trabecular connective density were calculated from the micro images (n=5). rrows in 5 mo old mice show areas of proteoglycan loss and cartilage fibrillation, respectively. rrows in 8 mo old mice show osteophyte formation and an area of proteoglycan loss in articular cartilage, respectively. Yellow arrows in micro images denote osteophyte formation. Scale bars, µm. Figure S5. blation of in articular chondrocytes in vivo. () Representative fluorescence microscopy shows recombination efficiency in mo gcre ER ; m/m mice followed by tamoxifen injection for 5 days (n=). () protein knock-down in mo articular chondrocytes of mice compared to re + control (trl) littermates (n=). Scale bars, µm. Figure S. Expression of Dnmt as well as anabolic and catabolic genes in cartilage tissue. () qpr analysis of Dnmts and ets in mo articular cartilage isolated from and re+ control (trl) mice (n=). () et activity analysis in chondrocytes from mo or trl mice (n=). ()ola (anabolic) and ola, Runx and Mmp (catabolic / hypertrophic) marker expression in articular chondrocytes from mo and re + control (trl) mice (n=). Figure S7. nalysis of apoptosis and reactive oxygen species in cartilage. () Representative UNEL staining and analysis of knee joint articular cartilage tissue sections from 5 mo and re+ control (trl) mice by fluorescence microscopy (n=5); () Quantification of apoptotic cell numbers from the UNEL-stained fluorescent images (n=5). () Reactive oxygen species (ROS) analysis of mo articular chondrocytes (i.e. chondrocytes from f/f mice treated with d5-re for 8 h) compared to control (trl) chondrocytes ( chondrocytes treated with d5-fp for 8 h) (n=). Figure. ltered epigenomic and transcriptomic signatures in chondrocytes. gdn and RN isolated from control and cells for RN-seq and methyl-seq analysis (n=). ()
4 P plot of samples based on RN-seq data; () Heatmap display of top 5 significantly differentially expressed genes between and control; () Word cloud representing gene frequency of enriched function categories from all differentially expressed genes; (D) lobal methylation distribution of and control samples showing there is no global difference; (E) Methylation difference of DMR versus genome as background; (F) Significant overlap of genes nearby DMRs and differentially expressed genes, p-values calculated by hypergeometric test. Figure S8. nalysis of RN-seq and methyl-seq data. () Heatmap of sample-to-sample distances using the rlog-transformed values showing more similarity of RN-seq signal observed in each group; () n M-plot of gene expression changes. he log fold change for a particular comparison is plotted on the y-axis and the average of the counts normalized by size factor is shown on the x-axis. Each gene is represented with a dot. enes with an adjusted p value below a threshold (here., the default) are shown in red; () Enrichment of differentially expressed genes show enriched function related to cell cycle process, bone development etc; (D) enes from differentially expressed list are related with F/MP pathway network, green indicates down-regulation and red indicates up-regulation; (E) enomic feature distributions of DMRs; (F) Enriched transcription factor binding sites found in DMRs using Homer software. n=. Figure. Mitochondria function and cellular homeostasis in chondrocytes. Primary articular chondrocytes were isolated from mo f/f mice and infected with d5-re ( ) or d5- FP (trl) for 8 h. () Mitochondrial respiration was measured by the Seahorse XF Extracellular Flux nalyzer. asal respiration and maximal respiration, as measured by the oxygen consumption rate (OR) are shown (n=8). () metabolite (succinate, fumarate) and NDH analysis by HPL-MS (n=). () Mitochondrial metabolism analysis was measured in mo W cells treated with either mm diethyl succinate or vehicle for 8 h by the Seahorse XF Extracellular Flux nalyzer (n=8). (D) Mitochondrial respiration analysis in MP--treated mo W chondrocytes in the presence or absence antimycin + rotenone for 8 h (n=8).
5 Figure S9. hondrocyte gene expression in cells. Primary articular chondrocytes were isolated from mo f/f mice and infected with d5-re ( ) or d5-fp (trl) for 8 h. Expression of anabolic (ola) or catabolic/hypertrophic genes (ola, Runx, Mmp) is shown (n=). Figure S. hondrocyte gene expression under succinate treatment. Primary articular chondrocytes from mo W mice were treated with mm diethyl succinate or vehicle for 8 h. () ellular succinate levels in murine chondrocytes (n=). () hondrocyte gene expression in response to succinate treatment was analyzed by qpr (n=). Figure S. hondrocyte gene expression under antimycin and rotenone (&R) treatment. Primary articular chondrocytes form mo W mice were treated with. µμ antimycin and rotenone for 8 h. () Effect of antimycin and rotenone treatment on chondrocyte proliferation and apoptosis (n=). () nalysis of chondrocyte gene expression in response to MP- treatment + / - antimycin + rotenone (n=). Figure 5. gain-of-function mice are protected from cartilage degeneration following surgical induction of O. MLI or sham surgeries were performed on gain-of-function (OF) mice or re + control (trl) mice. () lcian blue / hematoxylin / orange stained sections of trl or OF knee joints weeks following sham surgery. Representative images of histological sections from trl or OF mice at 8 wk or wk following MLI surgery (n=5). he magnified images of the boxed regions are shown respectively. () Quantitation of histological assessment by ORSI scoring (n=5). () Histomorphometric analysis of trl or OF cartilage (n=5). Scale bars, µm. Figure. Mitochondria function and cellular homeostasis in OF chondrocytes. () ene expression in chondrocytes isolated from wk trl or OF chondrocytes (n=). () Mitochondrial respiration in primary articular chondrocytes isolated from mo olare; Rosa-rt f/+ ;
6 -tg mice, treated with vehicle (trl) or doxycycline ( OF) for 8 h (n=). Mitochondrial respiration was measured by the Seahorse XF Extracellular Flux nalyzer. Figure S. eneration of gain-of-function (OF) transgenic mice. () Schematic representation of the strategy utilized to generate doxycycline (DOX)-inducible over-expression in murine cartilage tissue. () enotyping strategy, utilizing three different primer pairs, to confirm recombination. Mouse line #9 was used for breeding and subsequent experimental analyses. Figure S. Over-expression of in articular chondrocytes in vivo. () Representative fluorescence microscopy shows recombination efficiency in wk olare; Rosa-rt f/+ ; HFP mice (n=). Scale bar, µm. () onfirmation of protein over-expression in primary articular chondrocytes from wk OF or re + control (trl) mice by Western blotting using antibodies (n=).
7 Figure S E8.5 P7 P8 P5
8 Figure S Relative ene Expression..8. OL trl IL-β MMP trl IL-β
9 Figure S Mouse -8-5 Human -9 - Dog Horse -9 - Promoter ctivity.5.5 trl IL-β IL-β -pl -pl m-pl Signal relative to input.9.. Positive ontrol Negative ontrol nti-nfκ 5bp bp D mrn expression..8. E trl IL-β F β ctin trl IL-β : Input : Positive control : Negative control : nti-nfκ
10 Figure S Relative ene Expression..8. trl sirn β-ctin trl sirn Relative ene Expression..8. trl ola sirn ola...8 trl sirn.8.. trl Runx sirn Mmp.5.5 trl sirn D trl sirn MP E trl sirn F trl sirn psmad psmad/5 Smad Smad/5 β-ctin β-ctin
11 Figure S5 m/m gcreer;m/m trl β-ctin
12 Figure S Relative ene Expression..8. Dnmt trl..8. Dnmta trl.5.5 et trl..8. et trl.5.5 et trl E activity (normalized to trl).5.5 trl Relative ene Expression..8. ola trl 8 ola trl Runx trl.5.5 Mmp trl
13 Figure S7 trl % UNEL Positive ells 5 5 trl ROS (relative to trl) trl
14 Fig. S8... log fold change.... trl trl trl e+ e+ e+ e+ mean expression 8 E Enrichment of differentially expressed genes % cell cycle process 8% mitotic cell cycle skeletal system development ossification bone development % regulation of osteoblast 9% differentiation synapse organization regulation of ossification Intron Sox bits Nfatc p=e- bits RNN p=e-5 bits Inflammatory response Pax:Fkhr p=e- lp Foxk bits SMD Sox p=e-7 9 MMP Promoter hondrogenesis related p=e- 5 RUNX 5 bits Foxc SMD SMURF bits SMD7 p=e-5 SMURF Intergenic FoxO-related mor pathway, energy metabolism Smad/-Smad Exon F Smad/ D 8 8 -log P-value osteoblast differentiation
15 Figure S9 Relative ene Expression.5.5 ola trl ola 8 trl Runx trl Mmp trl
16 Figure S Succinate onc (ng/ml) Veh Succinate Relative ene Expression..8. ola ola Runx Mmp Veh Succinate Veh Succinate Veh Succinate Veh Succinate
17 Figure S Proliferation (% of trl)..8. poptosis (% of trl)..8. Veh &R Veh &R Relative ene Expression..8. ola ola Runx Mmp Veh &R Veh &R Veh &R Veh &R
18 Figure S loxp loxp Rosa SOP rt + ola-re Rosa rt rt teto + DOX teto b c d b c d Primers b, b Primers c, c Primers d, d Kb 5bp Kb 5bp Kb 5bp
19 Figure S olre;rosa-rt f/+ ;HFP trl OF β-ctin
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
More informationNature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
More informationFigure S1, Beyer et al.
Figure S1, eyer et al. Pax7 Myogenin si sitrl Hoechst T = 72h 14 1.8.6.4.2 12 1 8 6 4 2 24h 48h 96h diff. sitrl siset1 212 72h diff. b1 td r t Se km MyH Vinculin Myogenin β-ctin Vinculin MW b1 ka td r
More informationProbe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
More informationTitle: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events
Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul
More informationDNA methyltransferase 3b regulates articular cartilage homeostasis by altering metabolism
DNA methyltransferase 3b regulates articular cartilage homeostasis by altering metabolism Jie Shen, 1 Cuicui Wang, 1 Daofeng Li, 2 Taotao Xu, 1,3 Jason Myers, 4 John M. Ashton, 4,5 Ting Wang, 2 Michael
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationSupplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate,
Supplemental Tables and Figures The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate, tendon-specific protective mechanism against heterotopic ossification Timothy Mead et al Supplemental
More informationSupplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationSupplemental Information. A Highly Sensitive and Robust Method. for Genome-wide 5hmC Profiling. of Rare Cell Populations
Molecular ell, Volume 63 Supplemental Information Highly Sensitive and Robust Method for enome-wide hm Profiling of Rare ell Populations Dali Han, Xingyu Lu, lan H. Shih, Ji Nie, Qiancheng You, Meng Michelle
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationAdditional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.
Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationA. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
More informationLung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1
a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac
More informationAP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
More informationSupplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
More information6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells
6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells 6.1 TNF-α induces mitochondrial oxidative stress in SH-SY5Y cells. The dysregulation of mitochondria and oxidative
More informationfl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationPostn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
More informationSupplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
More informationSupplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated
Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationDiscovery of a Small Molecule Inhibitor of the Wnt Pathway as a Potential Disease Modifying Treatment for Knee Osteoarthritis
Discovery of a Small Molecule Inhibitor of the Wnt Pathway as a Potential Disease Modifying Treatment for Knee Osteoarthritis Charlene Barroga, Ph.D., Yong Hu, Ph.D., Vishal Deshmukh, Ph.D., and John Hood,
More informationThe Contribution Of Tie2-Lineage Cells To rhbmp-2 Induced Bone Formation
The Contribution Of Tie2-Lineage Cells To rhbmp-2 Induced Bone Formation Mille P. Kolind, Ph.D 1, Alastair Aiken 1, Kathy Mikulec 1, Lauren Peacock 1, David Little 1,2, Aaron Schindeler, PhD 1,2. 1 Orthopaedic
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationSupplemental Figure 1. Egr1 expression in adult Achilles tendons. (A,B) Achilles tendons were isolated from 2 month-old Egr1 +/- mice and stained for
Supplemental Figure 1. Egr1 expression in adult Achilles tendons. (A,B) Achilles tendons were isolated from 2 month-old Egr1 +/- mice and stained for LacZ activity, which reflects Egr1 expression. (A)
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationSupplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSupplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
More informationBreeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
More informationEffects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
More informationSupplemental Data. Wnt/β-Catenin Signaling in Mesenchymal Progenitors. Controls Osteoblast and Chondrocyte
Supplemental Data Wnt/β-Catenin Signaling in Mesenchymal Progenitors Controls Osteoblast and Chondrocyte Differentiation during Vertebrate Skeletogenesis Timothy F. Day, Xizhi Guo, Lisa Garrett-Beal, and
More informationSupplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
More informationInfect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter
Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SM library or vector Introduce reporter Grow cells in presence of puromycin for 5 days Vector control SM library fewer surviving cells More surviving
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationhemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and
More informationExpanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More informationSupplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
More informationComparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
More informationSpecies differences in histomorphometry
Species differences in histomorphometry Reinhold G. Erben Department of Biomedical Sciences Institute of Physiology and Pathophysiology University of Veterinary Medicine Vienna Purpose of histomorphometry
More information7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSupplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More informationStewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationSoluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,
Revised Suppl. Data: Soluble ADAM33 1 Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David
More informationAppendix Figure S1 A B C D E F G H
ppendix Figure S1 C D E F G H ppendix Figure S1. RT and chemotherapy alter PD-L1 expression in PDC cells. Flow cytometric analysis of PD-L1 expression in () KPC and () Pan02 cells following treatment with
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationRice in vivo RNA structurome reveals RNA secondary structure conservation and divergence in plants
Rice in vivo RN structurome reveals RN secondary structure conservation and divergence in plants Hongjing Deng 1,2,,5, Jitender heema 3, Hang Zhang 2, Hugh Woolfenden 2, Matthew Norris 2, Zhenshan Liu
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationControl. csarnt -/- Cre, f/f
ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct
More informationSupplemental Figure 1: Lrig1-Apple expression in small intestine. Lrig1-Apple is observed at the crypt base and in insterstial cells of Cajal, but is
Supplemental Figure 1: Lrig1-Apple expression in small intestine. Lrig1-Apple is observed at the crypt base and in insterstial cells of Cajal, but is not co-expressed in DCLK1-positive tuft cells. Scale
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
More informationSupporting Information
Supporting Information ou et al..73/pnas.08791112 dd Thymidine Release & transfection dd Thymidine Release dd MG132 Fix and IF -14 h 0 h 8 h 24 h 34 h 36 h siontrol simps1-1 simps1-1 simps1-1 simps1-2
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
More informationNLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationMetabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
More informationNature Immunology doi: /ni.3268
Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,
More informationSuppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes
More informationSupplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
More informationSupplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
More informationSupplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationnature methods Organelle-specific, rapid induction of molecular activities and membrane tethering
nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More informationTitle: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease
1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak
More informationBeuling _SupplFig. 1
euling _SupplFig. 1 Gata6: F: 5 -GGGTGTGG-3 R: 5 -GTGGTTGT-3 hga: F: 5 -GT-3 R: 5 -TTTTTTTT-3 Gcg: F: 5 -TTGGGTGGTTTG-3 R: 5 -TGGGGTGTTGTGGTG-3 Pyy: F: 5 -GGGGGG-3 R: 5 -GGGGGGTG-3 Muc2: F: 5 -TTGTGTGTG-3
More informationSUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
More informationSupplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More informationSupplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance
Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather
More informationSupplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
More information