SET-ting the Stage for SREBP Dependent Regulation of Lipid Metabolism
|
|
|
- Emory Floyd
- 5 years ago
- Views:
Transcription
1
2 SET-ting the Stage for SREBP Dependent Regulation of Lipid Metabolism
3 SET-ting the Stage for SREBP Dependent Regulation of Lipid Metabolism Sterol Regulatory Element Binding Proteins (SREBPs)
4 relative mrna relative mrna Rel. Exp. Hepatic SET-Domain SETDB2 proteins is Increased with Fasting Males (6weeks) 8 Males (6weeks) 6 * SETDB2 Fed Fast 8 6 SETDB2 4 2 Fed Fast *p-value < Liver Kidney Heart Adipose 0 Liver Kidney Heart Adipose Low High Fed Fast
5 SET-Domain proteins SETDB2 SET domain family of methyltransferases (50 total) Most similar to known histone H3K9 Me Enzymes Also called--clld8 or KMT1F Fly Orthologue is eggless (pachytene cytoplasm)
6 Rel. Exp. relative mrna Rel. Exp. relative mrna SETDB2 mrna and Protein in MPH SET-Domain proteins Selective Induction by Glucocorticoids Setdb2 may be esse MPH% shcontrol%shsetdb2 $$/$$$$$$$$+$$$$$$$/$$$$$$$$+$$$$ G6pase G6Pase (MPH) Setdb2 (MPH) Setdb2 - + DEX Setdb2 GR SP1 0 Control Isoproterenol Forskolin Dexamethasone Insulin Glucagon 0 Control Isoproterenol Forskolin Dexamethasone Glucagon Insulin
7 relative mrna Rel. Exp. relative mrna Dexamethasone+upregulates+hepa6c+Setdb2+in#viv SETDB2 mrna and Protein In Vivo SET-Domain proteins Induction by Glucocorticoids Setdb2+(liver)+ 15 Setdb2 RNA (Liver) 20 Protein Nuclear+ Cytoplasm Con. PBS+ DEX+ SETDB2 PBS+ DEX 5 5 YY1 0 0 PBS PBS DEX Dex Pending:+ in#vivo#
8 % of cells S phase DEX D SET-Domain proteins SETDB2 Diverse Roles in Physiology es SETDB2 U1C Liver Damage GR Signaling Laminopathies SETDB S Cell Cycle KO U1C/Splcing Hr. WT
9 SET-Domain proteins Setdb2 Overexpression In Vivo: Hepatic Fibrosis GFP msetdb2 msetdb2 GFP msetdb2 msetdb2
10 Setdb2 Overexpression Increases Hepatic Pro-Fibrotic Genes relative mrna Rel. Exp. relative mrna Rel. Exp. 10 TGFB3 TGF-β3 8 Col1a1 Col1A Ad-GFP Ad-mSetdb2 0 Ad-GFP Ad-mSetdb2
11 relative mrna Rel. Exp. Setdb2 Knockdown Decreases Hepatic Pro- Fibrotic Genes Rel. Exp. relative mrna relative mrna Rel. Exp. 1.5 Liver CCl4(48hrs) Setbdb2 1.5 TGFB3 TGF-β3 1.5 Col1a1 Col1A shcontrol shsetdb Setdb2 0.0 Cyp2b10 SH-Ctrl SH-mSetdb2 0.0 SH-Ctrl SH-mSetdb2
12 relative mrna Rel. Exp. Setdb2 Knockdown Attenuates CCl 4 Driven Liver Damage shsetdb2 shcontrol 1.5 Liver CCl4(48hrs) Setbdb2 OIL CCl 4 (48hrs) 1.0 shcontrol shsetdb2 0.5 * 0.0 Setdb2 Cyp2b10 *p-value<0.05
13 shsetdb2 shcontrol Setdb2 Knockdown Attenuates CCl 4 Driven Liver Damage shcontrol shsetdb2 OIL CCl 4 (48hrs) OIL CCl 4 (48hrs) H/E TUNNEL 100 μ
14 ALT activity (nmol/min/ml) nm/min/ml Setdb2 Knockdown Attenuates CCl 4 Driven Liver Damage ugtg/mg ug/mg tissue 250 ALT Serum ALT 40 TG Liver TAG GFP OIL SH * GFP SH CCl GFP OIL SH * GFP SH CCl4 Oil CCl 4 Oil CCl 4 *p <0.05
15 APAP Saline SETDB2 Knockdown Attenuates APAP-Liver Damage shcontrol shsetdb2 APAP-acetaminophen
16 Elevated SETDB2 mrna in Human Fibrosis * *n=6-10, p<0.05 Karine Clement
17 Elevated Nuclear SETDB2 in Human Steatosis/NASH osis y liver, no 1446 liver NASH damage with Significant Fibrosis 1784 NASH Fibrosis with light 1516 fibrosis Steatosis Control SETDB2 Steatosis with light 1517 fibrosis Healthy liver, no liver 1446 damage NASH with Significant 1784 Fibrosis NASH with Fibrosis light fibrosis 1516 Ste Nuclei SETDB2 staining NASH NASH 1517 Healthy liver, no liver damage 1784 NA
18 NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Aut Author Manuscript Biochem Biophys Res Commun. Author manuscript; available in PMC 2011 July 1. Glucocorticoids Published in final edited form as: and Drug-Induced Liver Injury Biochem Biophys Res Commun July 2; 397(3): doi: /j.bbrc Pathologic Role of Stressed-Induced Glucocorticoids in Drug- Induced Liver Injury in Mice Mary Jane Masson, Lindsay A. Collins, Leah D. Carpenter, Mary L. Graf, Pauline M. Ryan, Mohammed Bourdi, and Lance R. Pohl Molecular and Cellular Toxicology Section, Laboratory of Molecular Immunology, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD 20892, USA Mary Jane Masson: Lindsay A. Collins: Leah D. Carpenter: Endogenous glucocorticoids Mary L. play Graf: a role in acetaminophen-induced Pauline M. Ryan: Mohammed liver injury Bourdi: (AILI); Lance R. Pohl: dexamethasone worsens AILI and RU486 pretreatment attenuates damage. (Masson, 2010) Abstract We previously reported that acetaminophen (APAP)-induced liver injury (AILI) in mice is associated with a rise in serum levels of the glucocorticoid (GC), corticosterone. In the current study, we provide evidence that endogenous GC play a pathologic role in AILI. Specifically, pretreatment of mice with the GC receptor (GCR) inhibitor, RU486 (mifepristrone), protected normal but not adrenalectomized mice from AILI, while pretreatment with dexamethasone, a synthetic GC, exacerbated AILI. RU486 did not affect the depletion of whole liver reduced GSH or the formation of APAP-protein adducts. It also had no effects on the formation of reactive oxygen species or the depletion of mitochondrial GSH or ATP. While RU486 pretreatment also protected against halothane-induced liver injury, it exacerbated concanavalin A (ConA)- and Prednisolone carbon tetrachloride exacerbates (CCl 4 )-induced acetaminophen, liver injury, demonstrating ethanol, the complexity and CCl of GC 4 - mediated effects in liver injury and different delays types of tissue liver injury. repair Conclusion: (Kwon, These 2014). results suggest that under certain conditions, elevated levels of GC might represent a previously unappreciated risk factor for liver injury caused by APAP and other drugs through the diverse biological processes regulated by GCR. Keywords Drug-induced liver injury; stress; RU486; acetaminophen; halothane INTRODUCTION Drug-induced liver injury (DILI) is a serious health problem that accounts for over 50% of the cases of acute liver failure in the United States [1]. While the occurrence of DILI is quite high due to the estimated >1000 drugs that have been associated with liver injury [ 2], with
19 DEX DMSO SETDB2 SET-Domain Knockdown proteins in Mouse Primary Hepatocytes shcontrol shsetdb2 SETDB2 Nuclei
20 DEX DMSO SETDB2 SET-Domain Knockdown proteins in Mouse Primary Hepatocytes shcontrol shsetdb2 SETDB2 Nuclei SETDB2 Knockdown blunts induction of GR target genes
21 DEX DMSO SETDB2 SET-Domain Knockdown proteins in Mouse Primary Hepatocytes shcontrol shsetdb2 SETDB2 Nuclei Select SETDB2 Knockdown blunts induction of GR target genes
22 Critical Role for Insig in SREBP Regulation ER C N INSIG SCAP SREBP Golgi C N S2P S1P N N N Nucleus SRE
23 Two Promoters for Insig2 ProA ProB E1a E1b ATG E2 E1a E2 Insig2a Tissue Restricted Inducible E1b E2 Insig2b Constitutive
24 relative mrna relative mrna Dex. Induction of Insig2a Requires SETDB Liver Liver-Insig2a PBS Dex shdb2-dex Primary MPH-Insig2a Hepatocytes PBS shdb2 PBS Dex Insulin
25 Would Dex. Blunt Feeding Induction of SREBPs In Vivo? Fast Refeed +/- Dex
26 mrna Dex. Blunts Glucocorticoids Feeding Dependent increase INSIG2 Induction and of decrease SREBP Nuclear targets SREBP in REFED livers Lane N-SREBP-1 N-SREBP-2 pgr Fasted Vehicle Vehicle Refed Dexamethasone GR YY Fast+Vehicle Refed+Vehicle Refed+DEX
27 SET-Domain Ob/Ob proteins Mouse Model
28 SET-Domain proteins Ob/Ob Mouse Model Leptin deficiency Zhang et al. Nature 1994 Hyperphagic, obese, fatty liver, insulin resistant Jeanreneaud Ann. Nutr. Ail Elevated hepatic TG synthesis (high SREBP-1c) Shimomura et al. J. Biol. Chem Elevated circulating glucocorticoids Liu et al. Diabetes 2003 Decreased hepatic 11b-HSD1 Liu et al. Diabetes 2003 Hepatic GC resistance??? Blake and Broner BBRC 1970 (TAT deficient)
29 SET-Domain proteins Dex. Normalizes SREBP-1c in Ob/Ob Mice Glucocorticoids increase Insig2a and decrease SREBP processing in Ob/Ob liver Vehicle Dex. DEX injection at ZT=12 and tissue harvest at ZT=0 Next: Does SETDB2 or GR knockdown interfere with DEXmediated inhibition of SREBP processing in Ob/Ob? DEX injection at ZT=12 and tissue harvest at ZT=0 M 08 Next: Does SETDB2 or GR knockdown interfere with DEXmediated inhibition of SREBP processing in Ob/Ob?
30 SETDB2 Connects GR to SREBP and Liver Lipid Metabolism GR SETDB2 is induced by GR in Liver (fasting) Interacts with GR complex, affects GR location/stability SETDB2 is increased during liver damage (CCl 4, APAP) Attenuated by SETDB2 knockdown---nash target SETDB2 and GR regulate Insig 2 expression Explains fasting and circadian regulation of Insig 2: Connects GR/SETDB2 to the SREBP pathway and lipid metabolism Dexamethasone decreases SREBP-1c in Ob/Ob mice Ob/Ob display hepatic glucocoriticoid resistance
31 Manuel Roqueta-Rivera Sepideh Khorasanizadeh SBMRI Xiaoman Li UCF Or Gozani Stanford Ben Garcia U. Penn Fabienne Foufelle U. Pierre et Marie Curie SBMRI Cores: Analytical Genomics Bioinformatics Imaging Histology Proteomics CPCCG/Chemical Genomics Stefan Herzig Heidelberg
32 SETDB2 Knockdown Blunts Dex. Induction of Select GR SET-Domain proteins targets (of metabolic stress) Mouse Primary Hepatocytes Nuclear Lysate shctrl shdb2 SETDB2 bactin Gene Symbol %decreased Fmo Fam107a 88 Tat 87 Cyp2b Setdb Igfbp Insig2 66 Lipin 57.5 Ppargc1a 57 Tgfb Nrc3c1 (Gr) 55
33 SETDB2 interacts with GR SET-Domain proteins Co-IP of endogenous proteins SETDB2-GR co-ip Input IgG SETDB DEX GR
34 SET-Domain proteins SET Domain Protein Classification SETDB2, methyltransferase; Most similar to known histone H3K9 Me3 Enzymes (H3K9Me3); AKA--CLLD8 and KMT1F Orthologue (?) of fly eggless (pachytene cytoplasm) Glaser (2006),Development 133,
35 Elevated Nuclear SETDB2 in Human Fibrosis/NASH Healthy NASH liver, with no Significant liver damage Fibrosis Fibrosis NASH Steatosis with light fibrosis 1516 Steatosis 1517 Healthy liver, no liver damage 1784 NASH with light fibrosis 1784 NASH with light fibrosis SETDB2 staining 1446 NASH with Significant Fibrosis Fibrosis 151 SETDB2 staining SETDB2 staining 1517 Healthy liver, no liver damage
36 SETDB2 interacts with GR SET-Domain proteins Co-IP of endogenous proteins SETDB2-GR co-ip Input IgG SETDB DEX GR SETDB2 Genome-Wide Localization?
37 SETDB2 ChIP-Seq Analysis SET-Domain proteins Genome Distribution 22,129 peaks, million reads 90-95% mapped Shawn Li, Jun Ding UCF
38 Homer de novo Motif Results SETDB2 Gene Ontology Enrichment ChIP-Seq Results Analysis SET-Domain proteins Known Motif Enrichment Results (txt file) Total Target Sequences Enriched = 15498, Total Background Motifs Sequences = Rank Motif Homer Known Motif Enrichment Results (SETDB2/) 1 HNF6 10% Homer de novo Motif Results Gene Ontology Enrichment Results 2Known Motif Enrichment Results (txt file) Total Target Sequences = 15498, Total Background Sequences = Rank Motif 41 GR half site 5.7% CEBPb 5% 74 Stat6, MafA, MafF, MafK, PAX7, FOXA2, RXR, PDX1 85
39 SETDB2 ChIP-Seq Analysis SET-Domain proteins Overlap with HNF6 and GR SETDB2 (22129) D B A C GR (41128) HNF6 (89533) A= 864 overlappping peaks for all three proteins
40 SET-Domain proteins Hepatic SETDB2, GR, and HNF6?? HNF6 GR Cell Cycle Proliferation Fibrosis Inflammation Carcinogenesis Differentiation Lipid Metabolism Organogenesis Cell Migration Cell-matrix adhesion Glucose Metabolism Bile Transport
41 ug/mg tissue Rel. RNA relative mrna Rel. RNA relative mrna Rel. RNA relative mrna Rel. RNA relative mrna SETDB2 Knockdown In Vivo SREBP Target Gene Expression Liver TAG Scd1 Setdb2 Insig2a 5.05 Scd1 Hmgcr 1.5 * 2.0 * * 1 * shctrl shdb2 0.0 shctrl shdb2 0 shctrl shdb2 0.0 shctrl shdb2 15 Liver TG *p< # 5 0 shctrl shdb2 # p=0.004
42 Dex. Blunts Feeding Dependent Induction of SREBP Target Genes relative mrna Fast+Vehicle Refed+Vehicle Refed+DEX Insig1 Insig2a Hmgcr Fasn G6pc
43 Does Dex. Inhibition of SREBPs In Vivo Require SETDB2 and Insig2 and GR? sh-setdb2 sh-gr sh-insig2 7 days Fast Refeed +/- Dex
44 SETDB2 is Required for Dex. Inhibition of Nuclear SREBP Accumulation Refed DEX + Ad-shSetdb2 SETDB2 SREBP-1 SREBP-2 pgr (ser211) GR YY1 pooled n=5
45 Mem. Nuclear Dex. Inhibition of SREBP Requires SETDB2 and INSIG DEX (10mg/kg) SREBP1 pgr SETDB2 YY1 INSIG2 CALNEXIN Refed 8hr pooled n=5
46 relative mrna relative mrna relative mrna GR is Required for Dex. Srebp1c Induction of Insig2a in 5 Primary Hepatocytes Nr3c1 1 0 shctrl shgr DMSO DEX Insig2a shctrl shgr 0 shctrl shgr DMSO DEX DMSO DEX
47 SETDB2 and GR at the Insig2 Locus GR (DEX) GR (Vehicle) Setdb2 (DEX) Setdb2 (Input) DNAse (DEX) DNAse (Vehicle) Insig2 ProA ProB E1a E1b ATG E2
48 SETDB2 and GR at the Insig2 Locus GR (DEX) GR (Vehicle) Setdb2 (DEX) Setdb2 (Input) DNAse (DEX) DNAse (Vehicle) Insig2 ProA ProA E1a E1b ATG E2
49 %input %input SETDB2 and GR at the Insig2 Locus GR (DEX) GR (Vehicle) Setdb2 (DEX) Setdb2 (Input) DNAse (DEX) DNAse (Vehicle) IgG IgG IgG kb) SETDB2 GR GR kb) on1) shctrl+pbs shctrl+pbs shctrl+dex shctrl+dex shdb2+dex shdb2+dex shgr+dex shgr+dex on2) 3kb) n1) n2) kb) IgG IgG SETDB2.6kb) SETD on1)
50 %input %input %input %input %input SETDB2, GR and HNF6 at Insig 2 Locus IgG Reciprocal Binding by Dex. Insig2 (-1.6kb) H3K9me2 H3K9me2 GR SETDB2 HNF6 IgG GR SETDB2 HNF6 1.5 REFED DEX IgG Refed Dex. REFED REFED DEX DEX IgG IgG Tat Tat Insig H3K9 me2 Insig2 Cyp2b10 IgG Fasn Cyp2b10 Tat IgG H3K9me3 REFED DEX Fasn REFED DEX IgG H3K9 me3 Tat Insig2 Insig Cyp2b10 ProA ProB E1a E1b ATG E2 GR/SETDB2/ HNF6
51 % of cells S phase DEX D SET-Domain proteins SETDB2 Diverse Roles in Physiology es SETDB2 U1C Liver Damage GR Signaling Laminopathies SETDB S Cell Cycle KO U1C/Splcing Hr. WT
52 relative mrna Total Mem. Cyto p GR Regulates Circadian Expression ZT=0 of Hepatic ZT=12 Insig2a shctrl shgr shctrl shgr Insig2a ZT=0 1 2 ZT= ZT=0 ZT=12 shctrl shgr Membrane Nuclear shctrl shgr GR b-actin Insig2 Calnexin ZT=0; Dark to light NEXT:&GR&PTM&(lysine&acetyla5on&and&methyla5on)&and&SETDB2&knockdown G S G b In Ca
53 SREBPs Integrate Chronic Control (Gene Expression) with Acute Pathway Regulation (Enzyme Activity) Acetyl CoA HMGCR Mevalonate Long term control of enzyme synthesis ER C N INSIG SCAP SREBP Squalene Golgi C N S2P Rapid control of enzyme activity Cholesterol SCC N S1P Nucleus Cortisol
18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
Supplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
Supplementary information
Supplementary information High fat diet-induced changes of mouse hepatic transcription and enhancer activity can be reversed by subsequent weight loss Majken Siersbæk, Lyuba Varticovski, Shutong Yang,
Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
Cholesterol and Sphingolipids in Non-Alcoholic fatty liver disease.
Cholesterol and Sphingolipids in Non-Alcoholic fatty liver disease. José C. Fernández-Checa Liver Unit, Hospital Clinic CIBEK and IDIBAPS Instituto Investigaciones Biomédicas Barcelona Consejo Superior
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
Supplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
Supplemental Figures
Supplemental Figures Supplemental Figure 1. Fasting-dependent regulation of the SREBP ortholog SBP-1 and lipid homeostasis mediated by the SIRT1 ortholog SIR-2.1 in C. elegans. (A) Wild-type or sir-2.1(lof)
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
Regulation of Lipid Homeostasis: Lipid Droplets
Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells
Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis
SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego
The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease Ekihiro Seki, M.D.,Ph.D. University of California San Diego - A manufactured chemical. - Does not exist naturally. Carbon tetrachloride
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
Cholesterol and its transport. Alice Skoumalová
Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
cholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010
cholesterol structure most plasma cholesterol is in the esterified form (not found in cells or membranes) cholesterol functions in all membranes (drives formation of lipid microdomains) cholesterol is
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice
NASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
The SCAP/SREBP Pathway: A Mediator of Hepatic Steatosis
Review Article Endocrinol Metab 2017;32:6-10 https://doi.org/10.3803/enm.2017.32.1.6 pissn 2093-596X eissn 2093-5978 The SCAP/SREBP Pathway: A Mediator of Hepatic Steatosis Young-Ah Moon Department of
ab SREBP-2 Translocation Assay Kit (Cell-Based)
ab133114 SREBP-2 Translocation Assay Kit (Cell-Based) Instructions for Use For analysis of translocation of SREBP-2 into nuclei. This product is for research use only and is not intended for diagnostic
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
Non alcoholic fatty liver and Non alcoholic Steatohepatitis. By Dr. Seham Seif
Non alcoholic fatty liver and Non alcoholic Steatohepatitis By Dr. Seham Seif Definition NAFL describe a common clinicopathological conditions characterized by significant lipid deposition in the hepatocytes
Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice
Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice Julien Bricambert,, Catherine Postic, Renaud Dentin J Clin
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
Supplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
Yun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019
Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Foxm1 Transcription Factor is Required for Lung Fibrosis and Epithelial to Mesenchymal Transition.
Manuscript EMBO-2012-82682 Foxm1 Transcription Factor is Required for Lung Fibrosis and Epithelial to Mesenchymal Transition. David Balli, Vladimir Ustiyan, Yufang Zhang, I-Ching Wang, Alex J. Masino,
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary
Sirt1 Hmg20b Gm (0.17) 24 (17.3) 877 (857)
3 (0.17) 24 (17.3) Sirt1 Hmg20 Gm4763 877 (857) c d Suppl. Figure 1. Screen validation for top candidate antagonists of Dot1L (a) Numer of genes with one (gray), two (cyan) or three (red) shrna scored
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
High Content Imaging : Meaningful pictures for relevant results in dermocosmetology
High Content Imaging : Meaningful pictures for relevant results in dermocosmetology We deliver High Content screening services with exhaustive, high quality and robust phenotypic data. Nathalie MAUBON,
BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
Supplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
Understanding Root Cause: Pathogenesis of Hepatic Fibrosis
10/1/12 Understanding Root Cause: Pathogenesis of Hepatic Fibrosis Hepatitis C Virus Mild inflammation Inflammation Fibrosis Cirrhosis 1 10/1/12 Non-alcoholic Fatty Liver Disease Steatosis Steatohepatitis
Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar
http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids
Supplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
INCREASED CORTISOL PRODUCTION THROUGH THE H6PD/11β-HSD1 MACHINERY IN MG DEFICIENT LIVER CELLS
INCREASED CORTISOL PRODUCTION THROUGH THE H6PD/11β-HSD1 MACHINERY IN MG 2 2+ -DEFICIENT LIVER CELLS Dr. Andrea Roman ni, Chesinta Voma, Department of Physiology and Biophysics Case Western Reserve University
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1
a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac
Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
Constitutive Regulation of P450s by Endocrine Factors
References: Constitutive Regulation of P450s by Endocrine Factors Meyer UA. Endo-xenobiotic crosstalk and the regulation of cytochromes P450. Drug Metab Rev 39:639-46, 2007. Waxman DJ and O Connor C. Growth
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
Jang, H; Lee, GY; Selby, CP; Lee, G; Jeon, YG; Lee, JH; Cheng, KY; Titchenell, P; Birnbaum, MJ; Xu, A; Sancar, A; Kim, JB
Title SREBPc- signalling represses hepatic glucose production by promoting FOXO degradation during refeeding Author(s) Jang, H; Lee, GY; Selby, CP; Lee, G; Jeon, YG; Lee, JH; Cheng, KY; Titchenell, P;
The liver in poisoning: what can we learn from animal models?
The liver in poisoning: what can we learn from animal models? Stephan Krähenbühl Clinical Pharmacology & Toxicology University Hospital 4031 Basel/Switzerland Kraehenbuehl@uhbs.ch Outcome and causes of
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
The Role Of Crebh In Hepatic Energy Regulation Under Metabolic Stress
Wayne State University Wayne State University Dissertations 1-1-2015 The Role Of Crebh In Hepatic Energy Regulation Under Metabolic Stress Roberto Mendez Wayne State University, Follow this and additional
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
Lipogenic transcription factor ChREBP mediates fructose-induced metabolic adaptations to prevent hepatotoxicity
Lipogenic transcription factor ChREBP mediates fructose-induced metabolic adaptations to prevent hepatotoxicity Deqiang Zhang,, M. Bishr Omary, Lei Yin J Clin Invest. 2017;127(7):2855-2867. https://doi.org/10.1172/jci89934.
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c
Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla
Figure S1, Beyer et al.
Figure S1, eyer et al. Pax7 Myogenin si sitrl Hoechst T = 72h 14 1.8.6.4.2 12 1 8 6 4 2 24h 48h 96h diff. sitrl siset1 212 72h diff. b1 td r t Se km MyH Vinculin Myogenin β-ctin Vinculin MW b1 ka td r
Accessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity
ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
Master class Biomolecular Sciences Molecular Cell Biology.
Master class Biomolecular Sciences Molecular Cell Biology. 04-09-08: Paul van Bergen en Henegouwen. Clathrin-indep Endocytosis 11-09-08: Willem Stoorvogel. Endocytosis and MHC classii 18-09-08: X-track
Supplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
Supplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
University of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba
University of Groningen Non-alcoholic fatty liver disease Sheedfar, Fareeba IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
Thioredoxin-interacting (TXNIP) protein regulates the differentiation of erythroid precursors
Thioredoxin-interacting (TXNIP) protein regulates the differentiation of erythroid precursors Volker Blank Lady Davis Institute for Medical Research McGill University www.scientificimages.co.uk INSTITUT
Do Histological Features Inform DILI mechanisms?
Do Histological Features Inform DILI mechanisms? Drug-Induced Liver Injury (DILI) Conference XVII June, 2017 David Kleiner, M.D., Ph.D. NCI/Laboratory of Pathology Disclosures No financial or other conflicts
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination
E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments
The lipogenic transcription factor ChREBP dissociates hepatic steatosis from insulin resistance in mice and humans
Research article The lipogenic transcription factor ChREBP dissociates hepatic steatosis from insulin resistance in mice and humans Fadila Benhamed, 1,2,3 Pierre-Damien Denechaud, 1,2,3 Maud Lemoine, 4,5,6
Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in
9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade