Supplemental Information. Cardiac Fibroblasts Adopt Osteogenic Fates. and Can Be Targeted to Attenuate. Pathological Heart Calcification

Transcription

1 Cell Stem Cell, Volume 20 Supplemental Information Cardiac Fibroblasts Adopt Osteogenic Fates and Can Be Targeted to Attenuate Pathological Heart Calcification Indulekha C.L. Pillai, Shen Li, Milagros Romay, Larry Lam, Yan Lu, Jie Huang, Nathaniel Dillard, Marketa Zemanova, Liudmilla Rubbi, Yibin Wang, Jason Lee, Ming Xia, Owen Liang, Ya-Hong Xie, Matteo Pellegrini, Aldons J. Lusis, and Arjun Deb

2 Figure S1. Related to Figure 1 A Category Cluster Terms Count List Total Pop Hits Pop Total FDR SP_PIR_KEYWORDS Blue disulfide bond E-33 GOTERM_CC Blue extracellular region part E-16 GOTERM_MF Blue polysaccharide binding E-05 GOTERM_BP Blue immune response E-16 GOTERM_BP Blue locomotory behavior E-05 GOTERM_BP Blue regulation of cytokine production E-04 SP_PIR_KEYWORDS Magenta signal E-02 SP_PIR_KEYWORDS Orange signal E-12 SP_PIR_KEYWORDS Orange gpi-anchor E-03 GOTERM_BP Orange defense response E-03 KEGG_PATHWAY Orange drug metabolism E-05 GOTERM_BP Green cell cycle E-40 GOTERM_CC Green chromosome, centromeric region E-19 GOTERM_CC Green intracellular non-membrane-bounded organelle E-12 UP_SEQ_FEATURE Green nucleotide phosphate-binding region:atp E-08 GOTERM_BP Green microtubule-based process E-10 GOTERM_BP Green cell adhesion E-06 GOTERM_BP Green DNA metabolic process E-09 SP_PIR_KEYWORDS Green dna replication E-09 GOTERM_BP Green meiosis E-03 GOTERM_MF Green cytoskeletal protein binding E-03 SP_PIR_KEYWORDS Green extracellular matrix E-04 Figue S1A. List of families of genes upregulated in cardiac fibroblasts treated with osteogenic differentiation medium. Principal families of genes downregulated (green) or upregulated (blue, magenta, orange) in cardiac fibroblasts subjected to osteogenic differentiation compared to controls. (Count: the number of differentially expressed genes that overlap with genes associated with the biological term or gene family. List total: the total number of annotated differentially expressed genes within the category or ontology. Pop Hits: the number of genes within the ontology based category associated with the term. Pop Total: the total number of genes from the category. FDR: the false discovery rate) B Log Ratio TBX5 TBX2 CALCR SMOC1 BGN SCUBE3 THPO DLX5 ALPL TCIRG1 RUNX2 TBX3 OSCAR NT5E NFIL3 MEPE IBSP SOSTDC1 SP7 WDR5 EBF2 ALCAM SPARC OCSTAMP THY1 ITGAV ENPP1 FN1 COL1A1 DCSTAMP BGLAP KAZALD1 DCN DMP1 SMOC2 PTPRC OMD Figure S1B. Heat-map of temporal changes in osteogenic genes following induction of osteogenic differentiation of cardiac fibroblasts. Changes in expression (log2 fold) of a set of osteogenic genes in cardiac fibroblasts induced to undergo osteogenic differentiation (2 samples/each time point), versus control cardiac fibroblasts kept in the undifferentiated state. 7day.1 7day.2 14day.1 14day.2 21day.1 21day.2

3 Growth Medium Figure S2. Related to Figure 1 A Endothelial cell Cardiac fibroblast B C 100μm D 100μm 100μm E F CFs 14 Day Osteogenic medium (OM) 50μm Reseeding in two plates 14 Day Osteogenic medium (OM) Q-PCR Fold change in Runx2 expression Osteogenic DM 100μm Figure S2A-D. Cardiac fibroblasts and not endothelial cells can induce mineralization of the matrix. (A,B) Human endothelial cells or human cardiac fibroblasts were subjected to treatment with regular growth medium or (C,D) osteogenic differentiation medium for 21 days and stained for Alizarin Red to detect mineralization of the matrix (arrows, n=3). 30 ns D0 M O 14 + M+ OM O 4 14 OM 1 GM Day Growth medium (GM) Q-PCR Figure S2E,F. Stability of osteogenic gene expression upon removal of cardiac fibroblasts from an osteogenic environment. (E) Cardiac fibroblasts treated with osteogenic differentiation medium (14 days; Alizarin Red staining done to confirm calcium deposition) were lifted and reseeded in the presence of osteogenic differentiation medium (OM) or regular growth medium (GM) for another 14 days followed by harvesting of cells for qpcr. (F) Runx2 expression by qpcr did not significantly decrease when the cells were cultured in regular growth medium for a further 14 days versus osteogenic medium for 14 days, (ns=not significant, *p<0.05, n=3)

4 Figure S3. Related to Figure 1 A Wild type control 0.76% B Col1a2-CreERT:R26R tdtomato Pre sort Post sort purity- 48 ± 4.4% 99.06% Forward Scatter Forward Scatter C Wild type control 0.79% D FSP1-Cre:R26R tdtomato Pre sort Post sort purity ± 4.4% 98.0% E F G FSP1-Cre: R26R tdtomato Pre sort-fsp1-cre:r26r tdtomato 0.04% 16.22% Post sort purity - Sca-1 (+) Post sort purity - Sca-1 (-) 98.50% 0.50% 0.07% Sca-1 APC 23.74% Sca-1 APC 0.25% 97.00% ckit-apc H FSP1-Cre:R26R I Colony forming Unit Efficiency * Sca-1(+) Sca-1(-) 0.0 Sca-1(+) Sca-1(-)

5 Figure S3A-D. Flow cytometry mediated cell sorting of genetically labeled cardiac fibroblasts in Col1a2-CreERT:R26R and FSP1-Cre:R26R mice. (A,B) Expression of in cardiac fibroblasts in (A) wild type mice (no transgene) and (B) Col1a2-CreERT:R26R mice following tamoxifen mediated recombination with post sorting purity of isolated cardiac fibroblasts at 99%. (C,D) Expression of in (C) wild type mice (no transgene) or in (D) FSP1-Cre:R26R mice with post sorting purity of isolated cardiac fibroblasts at 98% (mean±s.e.m, n=7). Figure S3E-G. Expression of c-kit and Sca-1 in genetically labeled cardiac fibroblasts. (using FSP1-Cre:R26R mice) (E) Negligible expression of c-kit in labeled fibroblast cell population (F) Sca-1 expression in labeled cell population and (G) post soring purity of +Sca-1+ (98.5%) and +Sca-1 negative (97%) populations (mean±s.e.m., n=10) Figure S3H,I. Colony forming unit capacity of Sca-1+ and Sca-1 negative fibroblasts isolated from labeled cardiac fibroblasts of FSP1-Cre:R26R tdtomato mice. (H) Sca-1+ and Sca-1 negative labeled cardiac fibroblasts were seeded onto 10cm dishes at a seeding density of 10 3 cells and colonies stained with crystal violet (I) Quantitation of colonies demonstrates markedly diminished colony forming unit capacity of Sca-1 negative population (mean±s.e.m, CFU efficiency calculated as number of colonies formed per plate divided by 10 3 cells plated, n=4, *p<0.05).

6 Figure S4. Related to Figure 1 FSP1-Cre:R26R tdtomato FSP1-Cre:R26R tdtomato A C E NG2 Merged B D 50µm CD146 Merged 50µm F Figure S4A-F. Minimal expression of pericyte markers in labeled cardiac fibroblasts in hearts of FSP1Cre:R26R mice. Immunostaining for pericyte markers (A,C,E) NG2 and (B,D,F) CD146 in uninjured hearts of FSP1Cre:R26R mice shows (A,B) labeled cells (arrows) in close proximity to (C) NG2 or (D) CD146 (green, arrows) with merged image (E,F and inset) demonstrating lack of colocalization of fluorphores (arrows in merged image point to labeled cells that are distinct from the NG2 or CD146 expressing cells) (representative images of n=3). G H Pre sort FSP1-Cre:R26R tdtomato Post sort purity-pdgfrβ(+) 28.6% 95.3% Post sort purity-pdgfrβ(-) PDGFRβ APC 3.1% PDGFRβ APC 96.6% Figure S4G,H. Expression of PDGFRβ in labeled cardiac fibroblasts isolated from FSP1Cre:R26R mice. (G) Expression of PDGFRβ by flow cytometry in labeled cardiac fibroblasts (28.6%) and (H) determination of post sorting purity of +PDGFRβ+ (95.3%) and +PDGFRβ negative (96.6%) population (n=5).

7 Figure S5. Related to Figure 2 (A-E) and Figure 4 (F-M) A B C D CaHA OPN Merged F G H Troponin Runx2 Merged I J K E 10μm Merged 10μm 50μm CaHA 50μm Merged 50μm Runx2 Merged 10μm OCN Merged 10μm CD31 L M 10μm

8 Figure S5A-E. Expression of osteopontin by labeled cardiac fibroblasts at the site of injury. Region of calcified myocardium (Col1a2-CreERT:R26R mice, C3H background) following hydrocortisone injection demonstrating (A) region of calcium deposition (blue) (B) cardiac fibroblasts in the same field (red, arrows) (C) OPN expression in the same field (green, arrows) and (D) merged image showing expression of OPN by labeled cells (arrows) (E) Higher magnification of cells expressing OPN (arrows). Figure S5F-H. Cardiac myocytes do not express Runx2. Section of calcified myocardium (C3H mice) stained for (F) cardiac myocyte marker Troponin (G) Osteogenic marker Runx2 and (H) merged image demonstrating that Runx2 expressing cells (arrows) do not express the cardiac myocyte marker Troponin. Figure S5I-K. Cardiac calcification is not intravascular. Region of cardiac calcification (C3H mice) stained for (I) CD31 (red, showing a blood vessel, arrowhead) (J) calcium hydroxyapatite (green) and (K) merged image demonstrating no hydroxyapatite inside the blood vessel (red) (n=3, representative section shown). Figure S5L,M. Genetically labeled cardiac fibroblasts do not express osteogenic markers after cardiac injury in strains of mice that don t exhibit post injury myocardial calcification. Col1a2-CreERT:R26R mice (B6 background) were subjected to cryo injury and injured region examined at Day 7 post injury for expression of osteogenic markers. Immunofluorescent staining for (L) Runx2 (green) and (M) Osteocalcin (OCN) (green) demonstrates labeled cells (red, arrowheads) in the injured region but no expression of Runx2 or OCN. These data suggest that expression of osteogenic markers by labeled cardiac fibroblasts in our murine models of cardiac calcification does not represent a non-specific response to injury alone but rather is associated with the development of calcific response (representative images, n=4).

9 Figure S6. Related to Figure 6 A B6 C3H C B Uninjured Cryoinjured Uninjured Cryoinjured Category Strain Terms: Increased Expression Count List Total Pop Hits Pop Total SP_PIR_KEYWORDS B6 signal E-05 GOTERM_MF B6 carbohydrate binding E-06 GOTERM_BP B6 cell adhesion E-03 GOTERM_CC B6 extracellular region E-04 SP_PIR_KEYWORDS C3H glycoprotein E-70 GOTERM_CC C3H lysosome E-07 INTERPRO C3H Immunoglobulin subtype E-14 GOTERM_BP C3H regulation of cytokine production E-09 GOTERM_BP C3H cell activation E-14 GOTERM_BP C3H leukocyte activation E-14 GOTERM_BP C3H lymphocyte activation E-08 GOTERM_BP C3H T cell activation E-05 GOTERM_BP C3H chemotaxis E-05 GOTERM_BP C3H phagocytosis E-06 GOTERM_BP C3H cell proliferation E-04 GOTERM_CC C3H plasma membrane part E-04 SP_PIR_KEYWORDS C3H collagen E-07 GOTERM_BP C3H response to bacterium E-02 GOTERM_BP C3H positive regulation of immune response E-04 FDR D Color Key log 10 gene count B6_1_D7_N B6_2_D7_N B6_3_D7_N B6_1_D7_Inj B6_2_D7_Inj B6_3_D7_Inj C3H_1_D7_N C3H_2_D7_N C3H_3_D7_N C3H_1_D7_Inj C3H_2_D7_Inj Dcstamp Ocstamp Calcr Scube3 Sostdc1 Dmp1 Dlx5 Thpo Oscar Dcn Sparc Col1a1 Fn1 Bgn Smoc2 Tbx5 Wdr5 Alpl Thy1 Itgav Enpp1 Tcirg1 Ptprc Smoc1 Runx2 Omd Kazald1 Alcam Nt5e Ebf2 Tbx2 Tbx3 Nfil3 E Log Gene Count Osteogenic Signature Expression Distribution p >0.05 p < 0.03 B6_D7_N B6_D7_Inj C3H_D7_N C3H_D7_Inj F G SCUBE3 ENPP1 RUNX2 COL1A1 FN1 DCSTAMP OCSTAMP ALCAM PTPRC TCIRG1 BGN SCUBE3

10 Figure S6. RNA seq on injured and uninjured regions of C3H and B6 hearts. (A) B6 and C3H mice were injured and in each heart, injured and uninjured regions were used for comparison of gene expression changes. (B) Venn Diagram demonstrating the number of genes up and down regulated after injury in both C3H and B6 hearts. (note that about 960 genes are upregulated in the injured C3H heart region in contrast to 70 genes in the injured regions of B6 mouse hearts;) (C) List of differentially upregulated genes in both C3H and B6 injured heart regions, arranged in clusters according to DAVID functional annotation of genes. The highest rank biological terms from each cluster analysis is reported with a maximum false discovery rate (FDR) of (Count: the number of induced genes that overlap with genes associated with the biological term or gene family. List total: the total number of annotated induced genes within the category or ontology. Pop Hits: the number of genes within the ontology based category associated with the term. Pop Total: the total number of genes from the category. FDR: the false discovery rate) (D) Heat map demonstrating changes of osteogenic signatures between injured and uninjured B6 and C3H mouse heart regions. (N: Uninjured; Inj: Injured heart regions; numbers refer to the animal; D7: hearts were harvested at 7 days following injury; n=3 animals for B6 uninjured and injured hearts; n=3 for C3H uninjured hearts and n=2 for C3H injured hearts) (E) Changes in osteogenic signature shown in Figure 1D represented as a box plot. The black diamond represents the mean logarithmic gene count of the pooled values among the treatment replicates. A one-sided Welch's two sample t-test between the control and injured samples expression levels produced a p-value >0.05 between the control and injured samples for B6 hearts and p<0.05 between injured and uninjured C3H hearts. (F) Number and list of osteogenic genes differentially upregulated in injured B6 hearts. (G) Number and list of osteogenic genes upregulated in injured C3H hearts (note injured regions of C3H hearts upregulate 11 osteogenic genes vs only 1 gene in B6 hearts).

11 Figure S7. Related to Figure 6 A Uninjured B Injured CaHA ALP 100μm CaHA ALP 100μm C ALP Gene Expression (Fold Change) ns ns D Alkaline phosphatase (ng/mg tissue weight) ns ns 0 Uninjured Injured Uninjured Injured 0 Uninjured Injured Uninjured Injured B6 C3H B6 C3H Figure S7. Tissue non-specific alkaline phosphatase is abundantly present in uninjured and injured heart. (A,B) Immunostaining for alkaline phosphatase (red, arrows) in (A) uninjured and (B) injured C3H heart (note calcium deposits, green in injured heart) (C) qpcr to determine changes in expression of alkaline phosphatase pre and post injury in B6 and C3H mice demonstrate no significant change after injury (p>0.05, n=3). (D) An activity assay also demonstrates abundant but no significant change in alkaline phosphatase activity in injured vs uninjured B6 and C3H mouse hearts (p>0.05, n=3).

12 Table S1. Related to Figure 7 Table S1. Echocardiographic parameters in hearts of C3H animals injected with vehicle or etidronate prior to and post cardiac cryo-injury. (LVEDD: Left ventricular end diastolic diameter; LVESD: Left ventricular end systolic diameter) (data shown as mean±s.e.m; *p<0.05, n=6 animals for vehicle and n=8 animals for etidronate group). Heart rate refers to the heart rate at the time of acquisition of images. Pre injury Post injury Vehicle Etidronate Vehicle Etidronate LVEDD (mm) 2.12 ± ± ± ± 0.07 LVESD (mm) 0.91 ± ± ± ± 0.10 Ejection Fraction (%) ± ± ± ± 2.81 Fractional Shortening (%) ± ± ± ± 3.67 Heart rate (BPM) 600 ± ± ± ± * * * *

13 Table S2. Related to STAR method Table S2. Quantitative real-time PCR Primer sequence. Target gene Primer Sequence Accession Number Mouse Runx2 Mouse OSX Mouse OCN Mouse BSP Mouse OPN Mouse ENPP1 Mouse ALP Mouse GAPDH Human Runx2 Human GAPDH Forward- CCGTCCACTGTCACTTTAATAGC Reverse- GTAGCCAGGTTCAACGATCTG Forward- CTTCTTTGTGCCTCCTTTCC Reverse- GCGTCCTCTCTGCTTGA Forward- AGCAGAGTGAGCAGAAAGATG Reverse- GAACAGACAAGTCCCACACAG Forward- GAGAGTGTGGAAAGTGTGGAG Reverse- AGAAAATGGAGACGGCGATAG Forward- AGGGACTCCTTAGACTCACC Reverse- CTTGGCTTATGGACTGAGGT Forward- CTGACCACAGAAGATGATGACA Reverse- GTGGCGTGAGGAACCCATAA Forward- CCAACTCTTTTGTGCCAGAGA Reverse- GGCTACATTGGTGTTGAGCTTTT Forward- TGCACCACCAACTGCTTAGC Reverse- GGCATGGACTGTGGTCATGA Forward- GCCTAGGCGCATTTCAGGTGC Reverse- TGAGGTGACTGGCGGGGTGT Forward- AGCCACATCGCTCAGACAC Reverse- GCCCAATACGACCAAATCC NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_ NM_

14 SUPPLEMENTAL MOVIE LEGEND Movie S1. Related to Figure 5. 3D CT reconstruction of ectopic bone formation following injection of cardiac fibroblasts from explant cultures of injured and uninjured hearts into subcutaneous pockets of recipient mice. Mice are imaged with dorsal side up and cardiac fibroblasts (isolated from injured hearts) injected into a subcutaneous pocket over the right dorsum shows greater bone formation compared to the contralateral side (injected fibroblasts isolated from uninjured heart) or over the lower dorsum (no cells injected).