Supplemental Information. Cell-Autonomous Regulation of Astrocyte. Activation by the Circadian Clock Protein BMAL1

Size: px
Start display at page:

Download "Supplemental Information. Cell-Autonomous Regulation of Astrocyte. Activation by the Circadian Clock Protein BMAL1"

Transcription

1 ell Reports, Volume 5 Supplemental Information ell-utonomous Regulation of strocyte ctivation by the ircadian lock Protein ML1 rian V. Lananna, ollin J. Nadarajah, Mariko Izumo, Michelle R. edeño, avid. Xiong, Julie imitry, hak Foon Tso, elia. McKee, Percy Griffin, Patrick W. Sheehan, Jeffery. Haspel, en. arres, Shane. Liddelow, Joseph S. Takahashi, Ilia N. Karatsoreos, and rik S. Musiek

2 ML1 amka ire+ re ortex ML1 re + re PI Ki67 GFP MRG GFP % rea mal1 KO WT amka ire+ re GFP S MRG re- re+ Figure S1. Related to Figure 1; haracterization of mouse models with astrogliosis induced by loss of mal1.. Representative actigraph of a WT mouse housed in 1h:1h light:dark, then switched to h:h light:dark at black arrow, leading to behavioral arrhythmicity.. ortical qpr showing mrn levels from h:h light:dark WT mice from Fig. 1, S1 reveals increased Gfap expression at most timepoints throughout the circadian day.. Hippocampal (top, scale bars = 15μm) and cortical (bottom, scale bars = 5μm) staining of (red) and ML1 (green) from mo amka-ire+;mal f/f mice and re- controls shows complete loss of neuronal ML1 in re+ animals.. Representative images (top) and quantification (bottom) illustrating minimal localization of the cell division marker Ki67 staining with GFP+ astrocytes in cerebral cortex from mo Nestin-re+;mal1 f/f (Nmal1 KO) mice (left graph), despite large increases in GFP+ cells as compared to re- controls (right graph). Scale bar= 5μm.. Nmal1 KO mice have increased GFP+ activated astrocytes in the cerebral cortex without major changes in number of total (S+) astrocytes. Scale bar = 5μm. ll data represent mean+sm. p<.5 by -tailed T-test.

3 GFP ML1 MRG re GFP re+;mal1 wt/flox re+ re ldh1l1 re GFP GFP % rea G re Retrosplenial ortex p=.55 ns ns ldre - ldre + het ldre + agre - agre + LH1 re + LH1 re re- re+ PI F 8 6 p=.6 ML1 GFP MRG ldh1l1-re- ldh1l1-re+ Gfap Sa6 qp b xcl5 Mmp1 Timp1 Ggta d Serpina3n Figure S. Related to Figure ; haracterization of astrogliosis seen with loss of mal1 in vitro and in vivo.. qpr showing mrn levels of several astrocyte activation and inflammatory genes 7 days after treatment of WT astrocytes with non-targeting sirn (sisr) or sirn targeting mal1 (simal1). N=1-15 experiments.. Representative cortical images from mice in Fig. F-H. Top row. V8-GFP-GFP-infected cells (solid arrows) show whole-cell GFP expression, persistent colocalized nuclear ML1, and fail to colocalize with neuronal nuclei (hollow arrows). ottom row. V8-GFP-re infected cells show only nuclear GFP expression (solid arrows, re egfp fusion protein), loss of nuclear ML1 and fail to colocalize with neuronal nuclei (hollow arrows). Scale bar= 3µm.. Representative images, quantification of %GFP area in retrosplenial cortex of mice in Fig. H. Scale bar = µm.. Representative confocal images of ldh1l1-re+;mal f/f mice and re- controls. PI+, GFP+ (solid arrows) astrocytes colocalize with ML1 in re- mice, but not in re+ mice. Scale bar= 3µm.. Quantification of PI/GFP/ML1+ cells (top) or GFP+ cells per field of view (bottom) in ldh1l1-re+;mal f/f mice vs re- controls in hippocampus. ach data point = 1 mouse. 6 fields/mouse with an average of.5 GFP+ cells/field, totaling 1,176 cells counted. Note that there is not an increase in GFP+ cells in hippocampus, just the size and shape of these cells. F. mrn levels of astrocyte activation markers in hippocampus from ldh1l1-re+;mal f/f mice vs re- controls. ll data represent mean+sm. p<.5, p<.1, p<.1, p<.1 by -tailed T-tests (), (), and (F) or 1-way NOV () with Hom-Sidak correction for multiple comparisons when applicable.

4 6 Mmp1 re- re ZT (=light on) Rank ategory Term ount % PValue Genes Fold nrich enjamini FR 1 KGG_PTHWY mmu98:rug metabolism cytochrome P GSTM1, GST, FMO6, UGT16, UGT16, MO, OX1, GSTT1, GSTT, GSTT3, GSTM KGG_PTHWY mmu98:metabolism of xenobiotics by cytochrome P GSTM1, GST, UGT16, UGT16, HS111, GSTT1, GSTT, GSTT3, GSTM KGG_PTHWY mmu51:ilated cardiomyopathy Y3, Y, ITG8, NG5, IGF1, ITG3, N1F, TTN, N1S KGG_PTHWY mmu8:glutathione metabolism GSTM1, GST, IH, GSTT1, GSTT, GSTT3, GSTM KGG_PTHWY mmu5:hemical carcinogenesis GSTM1, GST, UGT16, UGT16, HS111, GSTT1, GSTT, GSTT3, GSTM KGG_PTHWY mmu6:fatty acid elongation , LOVL, HS1, OT1, OT KGG_PTHWY mmu35:tyrosine metabolism T, TYRP1, MO, OX1, TPO KGG_PTHWY mmu916:melanogenesis T, Y3, NR, TF7, WNT, TYRP1, Y, WNT KGG_PTHWY mmu5:hypertrophic cardiomyopathy (HM) ITG8, NG5, IGF1, ITG3, N1F, TTN, N1S KGG_PTHWY mmu5:pathways in cancer MP, TRF1, Y3, TF7, OL, OL1, Y, WNT3, IGF1, FGF3, ITG3, KR, R KGG_PTHWY mmu39:hippo signaling pathway MP, TF7, WNT, N, WNT3, GF5, T3, WWTR1, GLI, MP KGG_PTHWY mmu5:small cell lung cancer TRF1, MX, OL, OL1, ITG3, R1, LM KGG_PTHWY mmu95:ldosterone synthesis and secretion Y3, Y, MK1G, MK, MR, N1F, N1S KGG_PTHWY mmu:alcium signaling pathway Y3, NR, Y, MK, YSLTR, PHKG, PL1, N1F, KR, ITPK, N1S F G H Figure S3. Related to Figure 3; Pathway analysis, GSTx, and GSH with mal1 deficiency.. xpression of ML1 transcriptional targets and Gfap from microarray in Fig. 3 at T 6 and 18.. xpression of astrocyte activation transcripts Gfap, qp, and Mmp1 in cortex of Nmal1 KO (re+, red) and recontrol mice (black) at hour timepoints across the circadian cycle. No clear circadian oscillations were observed in re- or re+ mice. N=3- mice/genotype/timepoint.. KGG pathway analysis of Nmal1 KO microarray data. lue = pathways related to glutathione homeostasis.. qpr of mrn expression of glutathione transferases in the cortex of ig-re+;mal1 f/f mice (Fig. 3F), 9 days after tamoxifen treatment, normalized to re-, mal f/f controls.. qpr of mrn expression of glutathione transferases in hippocampus of ldh1l1-re+;mal1 f/f mice (Fig. H). F. GSH levels in mal1 KO (top) and simal1 treated WT (bottom) astrocyte enriched cultures along with appropriate controls as measured by fluorometric intracellular glutathione detection assay. G. Quantification of GSH and GSSG levels in cortical tissue (T ) from control, Nmal1 KO, and Per1/ mut mice. None of the averages were significantly different. H. mrn expression of mal1 and Nr1d1 in the cortex of ig-re+;mal1 f/f mice used in Fig. 3G, 9 days after tamoxifen treatment, normalized to re-, mal f/f controls. ll data represent mean±sm. p<.5, p<.1 by -tailed T-test with Holm-Sidak correction for multiple comparisons when applicable.

5 G re+astro G re astro Normalized GFP or Gfap level sisr simal1 sisr simal1 Model: Primary stros Means of mal1 KO: uration mal1 KO: sirn K 7- days 3 1 Gfap mrn GFP protein ldre - ldre + ldre - ldre + ldh1l1-re;mal mice Tamox-depen. re 8 weeks re- re- amka-ire+ MP SP-3 MRG Nestin-re+ re- amka-ire+ Nestin-re+ Nestin/amKa-re;mal1 mice onstitutive re 16 weeks asp+ puncta/mp % area re+ Figure S. Related to Figures 3 and ; omparison of Gfap mrn and GFP protein across experiments; Further characterization of neuronal support deficits observed with loss of mal1.. omparison of Gfap mrn (quantified by qpr) and GFP protein (quantified by immunofluorescence) across experiments in this manuscript. Note that in both cultures cells and two distinct re-lox mouse models, Gfap mrn and GFP protein are very closely related. ata is shown separately in Figs. 1 and.. Representative images showing MP+ (green) and cleaved-aspase-3+ (SP-3, red, arrows) WT neurons (grown as in Fig. ) at IV 7. Scale bar = μm.. Quantification of MP percent area (top) and cleaved-aspase-3+ (bottom) neurons from () shows nonsignificant trends toward decreased MP and increased cleaved-aspase-3+ neurons when neurons are plated on ML1-deficient astrocytes (re+). ll data represent mean+sm.

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic

More information

Supplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a)

Supplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a) 1 Supplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a) and CD45 (b) in fixed sections of binocular visual cortex

More information

Neocortex Zbtb20 / NFIA / Sox9

Neocortex Zbtb20 / NFIA / Sox9 Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

Figure S1, Beyer et al.

Figure S1, Beyer et al. Figure S1, eyer et al. Pax7 Myogenin si sitrl Hoechst T = 72h 14 1.8.6.4.2 12 1 8 6 4 2 24h 48h 96h diff. sitrl siset1 212 72h diff. b1 td r t Se km MyH Vinculin Myogenin β-ctin Vinculin MW b1 ka td r

More information

Expanded View Figures

Expanded View Figures Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and

More information

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9! Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson

More information

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,

More information

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell

More information

Figure 1 A 2.0. Akt308 Akt Ctl 1h 3h 6h 9h 12h. β-cat. GSK3β. pakt308. pgsk3β/edu E-cad/pAkt308. Akt1. Actin.

Figure 1 A 2.0. Akt308 Akt Ctl 1h 3h 6h 9h 12h. β-cat. GSK3β. pakt308. pgsk3β/edu E-cad/pAkt308. Akt1. Actin. Figure 1 pβcat552 β-cat pgsk3β GSK3β 110 110 pgsk3β/du -cad/ TL 20 µm 20 µm pkt473 pankt pkt473 pankt (days) 0 1 2 3 4 (h) 0 1 3 6 9 12 pβ-cat552/nuclei ensitometricanalysis (Pixel intensity) F ensitometricanalysis

More information

Primary Mouse Cerebral Cortex Neurons V: 80% TE: 70%

Primary Mouse Cerebral Cortex Neurons V: 80% TE: 70% Primary Mouse Cerebral Cortex Neurons V: 80% TE: 70% Pictures: 9 days after electroporation Red: MAP2 Blue: GFAP Green: GFP The cells were from Embryonic Day 14 Mouse Cerebral Cortex Primary Mouse Hippocampal

More information

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Table 1. Primer sequences for transcript analysis Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC

More information

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs. Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,

More information

mm Distance (mm)

mm Distance (mm) b a Magnet Illumination Coverslips MPs Objective 2575 µm 1875 µm 1575 µm 1075 µm 875 µm 545 µm 20µm 2 3 0.5 0.3mm 1 1000 100 10 1 0.1 1000 100 10 1 0.1 Field Induction (Gauss) 1.5 0 5 10 15 20 Distance

More information

Supplemental Figures Supplemental Figure 1:

Supplemental Figures Supplemental Figure 1: Supplemental Figures Supplemental Figure 1: Representative FACS data showing Concurrent Brain cell type Acquisition using either Percoll PLUS (top row) or myelin removal beads (bottom two rows). Debris

More information

Supplemental Information. The Hormone FGF21 Stimulates Water Drinking. in Response to Ketogenic Diet and Alcohol

Supplemental Information. The Hormone FGF21 Stimulates Water Drinking. in Response to Ketogenic Diet and Alcohol ell Metabolism, Volume 7 Supplemental Information The Hormone Stimulates Water Drinking in Response to Ketogenic Diet and lcohol Parkyong Song, hristoph Zechner, Genaro Hernandez, José ánovas, Yang Xie,

More information

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization

More information

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development 1 Frankie Hang Fung Lee, 1 Ping Su, 1 Yu Feng Xie, 1 Kyle Ethan Wang, 2 Qi Wan and 1,3 Fang Liu 1 Campbell Research Institute, Centre

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western

More information

Supplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently

Supplemental Information. Granulocyte-Monocyte Progenitors and. Monocyte-Dendritic Cell Progenitors Independently Immunity, Volume 47 Supplemental Information Granulocyte-Monocyte Progenitors and Monocyte-endritic ell Progenitors Independently Produce Functionally istinct Monocytes lberto Yáñez, Simon G. oetzee, ndre

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/10/e1500775/dc1 Supplementary Materials for Structural-functional connectivity deficits of neocortical circuits in the Fmr1 /y mouse model of autism Matthias

More information

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul

More information

Nature Neuroscience: doi: /nn.2275

Nature Neuroscience: doi: /nn.2275 Supplementary Figure S1. The presence of MeCP2 in enriched primary glial cultures from rat or mouse brains is not neuronal. Western blot analysis of protein extracts from (a) rat glial and neuronal cultures.

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human

More information

Expanded View Figures

Expanded View Figures MO reports PR3 dephosphorylates TZ Xian-o Lv et al xpanded View igures igure V1. PR3 dephosphorylates and inactivates YP/TZ., Overexpression of tight junction proteins Pals1 () or LIN7 () has no effect

More information

Figure 1. Dnmt3b expression in murine and human knee joint cartilage. (A) Representative images

Figure 1. Dnmt3b expression in murine and human knee joint cartilage. (A) Representative images Figure Legends Figure. expression in murine and human knee joint cartilage. () Representative images showing that Dnmta is not expressed in chondrocytes from mo W articular cartilage [Dnmta expression

More information

Nature Immunology: doi: /ni eee Supplementary Figure 1

Nature Immunology: doi: /ni eee Supplementary Figure 1 eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

Zhu et al, page 1. Supplementary Figures

Zhu et al, page 1. Supplementary Figures Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high

More information

Supplementary Figure 1. Chimeric analysis of inner ears. (A-H) Chimeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears.

Supplementary Figure 1. Chimeric analysis of inner ears. (A-H) Chimeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears. Supplementary Figure 1. himeric analysis of inner ears. (A-H) himeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears. (A,B) omposite images showing three colors in different vestibular

More information

An unconventional role for mirna: let-7 activates Toll-like receptor 7 and causes neurodegeneration

An unconventional role for mirna: let-7 activates Toll-like receptor 7 and causes neurodegeneration An unconventional role for mirna: let-7 activates Toll-like receptor 7 and causes neurodegeneration Sabrina M. Lehmann, Christina Krüger, Boyoun Park, Katja Derkow, Karen Rosenberger, Jan Baumgart, Thorsten

More information

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels

More information

Table S1. qpcr primer list.

Table S1. qpcr primer list. Table S1. qpr primer list. Genes Forward primer Reverse primer NANOG AAATGGGAAGAATAGA GGTTAGTGGGTTA PAX6 TTTTGTTGGGAAATG TGGTTAAATTTAG ASL1 AAGATGAAAGAAAG GGAGTTTGATTAA NHLH GTGGATAGATATTT ATATTTTGGAATTT

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets. Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated

More information

Supplementary information. Nkx2.1 regulates the generation of telencephalic astrocytes during embryonic

Supplementary information. Nkx2.1 regulates the generation of telencephalic astrocytes during embryonic Supplementary information Nkx2.1 regulates the generation of telencephalic astrocytes during embryonic development Shilpi Minocha 1*, Delphine Valloton 1*, Yvan Arsenijevic 2, Jean-René Cardinaux 3, Raffaella

More information

Nature Medicine doi: /nm.2860

Nature Medicine doi: /nm.2860 Supplemental Figure Legends Supplemental Figure 1: Hypomorphic expression of IFT88 results in olfactory signaling proteins no longer localizing to the ciliary layer. (a) ACIII localizes to the cilia and

More information

Expanded View Figures

Expanded View Figures Sarah Kit Leng Lui et al USP26 stabilizes SM7 MO reports xpanded View igures igure V1. USP26 enhances SM2 phosphorylation and T-b-mediated transcription. raph representing relative luciferase values obtained

More information

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,

More information

mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons

mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR

More information

M2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination

M2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination Supplemental Information Title: M2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination Authors: Veronique E. Miron, Amanda Boyd, Jing-Wei Zhao, Tracy J. Yuen, Julia M.

More information

Supplemental Figure 1

Supplemental Figure 1 mrn/ mirn expression 3.5 3.5.5.5 +Jagged mir-5+jagged Supplemental Figure HS mir-5 Z H HS mir-5 Z H HS mir-5 Z H HM MF PT HM JG HS Percentage of 4-44 + cells (%) mrn/mirn 8 6 4.5.5.5 mir-5 sh-jg +Jagged

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Fig. S1. Weights of full-dose treatment groups comparing 1 st, 2 nd, and 3 rd generation gene replacement therapy. Mice were treated at p1 with 4x10 11 GC of the three different

More information

Supplementary Information

Supplementary Information Supplementary Information Astrocytes regulate adult hippocampal neurogenesis through ephrin-b signaling Randolph S. Ashton, Anthony Conway, Chinmay Pangarkar, Jamie Bergen, Kwang-Il Lim, Priya Shah, Mina

More information

Supplementary Figures for

Supplementary Figures for mirns regulate s Supplementary igures for MicroRNs Reprogram Normal ibroblasts into Cancer ssociated ibroblasts in Ovarian Cancer nirban K. Mitra, Marion Zillhardt, Youjia Hua, Payal iwari, ndrea E. Murmann,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains

More information

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547 Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living

More information

Supplementary Information

Supplementary Information Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,

More information

Supplementary Information. Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module

Supplementary Information. Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module Supplementary Information Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module O Neil Wiggan, Bryce Schroder, Diego Krapf, James R. Bamurg and Jennifer G. DeLuca

More information

Sleep and Circadian Rhythms in Neurodegenerative Disorders

Sleep and Circadian Rhythms in Neurodegenerative Disorders Sleep and Circadian Rhythms in Neurodegenerative Disorders Erik S. Musiek, MD, PhD Department of Neurology Washington University in St. Louis U13 Bench to Bedside Sleep Conference 2015 Disclosures Funding:

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table. Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:

More information

Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like

Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like SUPPLEMENTL FIGURE LEGENDS Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like spheroids from a human brain tumor sample or glioma xenograft. () CD133+ tumor cells isolated

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/385/ra70/dc1 Supplementary Materials for The interaction of heparan sulfate proteoglycans with endothelial transglutaminase-2 limits VEGF 165 -induced angiogenesis

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor

More information

Supplementary Material

Supplementary Material Supplementary Material 1 PRISMA 2009 Flow Diagram Included Eligibility Screening Identification Records identified through database searching (n = 502) Records after duplicates removed (n = 271) Records

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission

Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission Jesica Raingo, Mikhail Khvotchev, Pei Liu, Frederic Darios, Ying C. Li, Denise

More information

Prss56, a novel marker of adult neurogenesis in the mouse brain. - Supplemental Figures 1 to 5- Brain Structure and Function

Prss56, a novel marker of adult neurogenesis in the mouse brain. - Supplemental Figures 1 to 5- Brain Structure and Function Prss56, a novel marker of adult neurogenesis in the mouse brain - Supplemental Figures 1 to 5- Brain Structure and Function Alexandre Jourdon 1,2, Aurélie Gresset 1, Nathalie Spassky 1, Patrick Charnay

More information

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)

More information

Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols

Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols used to differentiate mouse ESCs. (b) Representative

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

Control of CNS Cell-Fate Decisions by SHP-2 and Its Dysregulation in Noonan Syndrome

Control of CNS Cell-Fate Decisions by SHP-2 and Its Dysregulation in Noonan Syndrome Article Control of CNS Cell-Fate Decisions by SHP-2 and Its Dysregulation in Noonan Syndrome Andrée S. Gauthier, 1,2,3 Olivia Furstoss, 1,2 Toshiyuki Araki, 5 Richard Chan, 5 Benjamin G. Neel, 5 David

More information

Supplementary Figure 1. ACE robotic platform. A. Overview of the rig setup showing major hardware components of ACE (Automatic single Cell

Supplementary Figure 1. ACE robotic platform. A. Overview of the rig setup showing major hardware components of ACE (Automatic single Cell 2 Supplementary Figure 1. ACE robotic platform. A. Overview of the rig setup showing major hardware components of ACE (Automatic single Cell Experimenter) including the MultiClamp 700B, Digidata 1440A,

More information

Structural basis for the role of inhibition in facilitating adult brain plasticity

Structural basis for the role of inhibition in facilitating adult brain plasticity Structural basis for the role of inhibition in facilitating adult brain plasticity Jerry L. Chen, Walter C. Lin, Jae Won Cha, Peter T. So, Yoshiyuki Kubota & Elly Nedivi SUPPLEMENTARY FIGURES 1-6 a b M

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

Supporting Information

Supporting Information Supporting Information lpek et al. 1.173/pnas.1121217 SI Materials and Methods Mice. cell knockout, inos / (Taconic arms), Rag1 /, INγR /, and IL-12p4 / mice (The Jackson Laboratory) were maintained and/or

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.

Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones. Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific

More information

Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus

Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus a: Expression of Vimentin, GFAP, Sox2 and Nestin in anterior, central and posterior hypothalamus. In the anterior

More information

Cord blood monocytes as a source of cell therapy products for treatment of brain injuries ISCT/CBA 2015 Cord Blood Workshop Wednesday, May 27, 2015

Cord blood monocytes as a source of cell therapy products for treatment of brain injuries ISCT/CBA 2015 Cord Blood Workshop Wednesday, May 27, 2015 Cord blood monocytes as a source of cell therapy products for treatment of brain injuries ISCT/CBA 2015 Cord Blood Workshop Wednesday, May 27, 2015 Andrew E. Balber, PhD Senior Scientific Advisor CT 2,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

label the basement membrane). Different fixation methods of EB-perfused P8 mice to optimize the combination

label the basement membrane). Different fixation methods of EB-perfused P8 mice to optimize the combination Supplementary Figure 1 Optimization of the tissue fixation protocol to combine EB perfusion and IB4 endothelial tip cell staining in the postnatal mouse brain. a-l Labeling of EB-perfused P8 mice with

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo. Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Genetic labeling of microglia Male and female 2-3 month-old CreERT2;R26-tdTomato mice or CreERT2;R26-tdTomato;Iba1-eGFP transgenic mice were treated with 1x, 2x (48 h apart), or

More information

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn.

Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn. Supplementary Figure 1 SybII and Ceb are sorted to distinct vesicle populations in astrocytes. (a) Exemplary images for cultured astrocytes co-immunolabeled with SybII and Ceb antibodies. SybII accumulates

More information

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12. Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

More information

Supplemental Figure S1. RANK expression on human lung cancer cells.

Supplemental Figure S1. RANK expression on human lung cancer cells. Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/358/ra2/dc1 Supplementary Materials for Localized TRPA1 channel Ca 2+ signals stimulated by reactive oxygen species promote cerebral artery dilation Michelle

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a,

Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a, Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a, Transverse sections of E17.5 ovary and mesonephros from Gli1-LacZ reporter embryos (n=3) after LacZ staining (blue). The

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined

More information

Supporting Information

Supporting Information Supporting Information Song et al. 10.1073/pnas.1207238109 SI Materials and Methods Mice. To produce the GRP reer mouse line, the translational start TG in the mouse GRP genomic locus was replaced with

More information

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination

More information

Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter

Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SM library or vector Introduce reporter Grow cells in presence of puromycin for 5 days Vector control SM library fewer surviving cells More surviving

More information

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI

More information

McWilliams et al., http :// /cgi /content /full /jcb /DC1

McWilliams et al., http ://  /cgi /content /full /jcb /DC1 Supplemental material JCB McWilliams et al., http ://www.jcb.org /cgi /content /full /jcb.201603039 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. In vitro characterization of mito-qc. (A and B) Analysis

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 NLRP12 is downregulated in biopsy samples from patients with active ulcerative colitis (UC). (a-g) NLRP12 expression in 7 UC mrna profiling studies deposited in NCBI GEO database.

More information

Ahtiainen et al., http :// /cgi /content /full /jcb /DC1

Ahtiainen et al., http ://  /cgi /content /full /jcb /DC1 Supplemental material JCB Ahtiainen et al., http ://www.jcb.org /cgi /content /full /jcb.201512074 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Distinct distribution of different cell cycle phases in the

More information

Lack of GPR88 enhances medium spiny neuron activity and alters. motor- and cue- dependent behaviors

Lack of GPR88 enhances medium spiny neuron activity and alters. motor- and cue- dependent behaviors Lack of GPR88 enhances medium spiny neuron activity and alters motor- and cue- dependent behaviors Albert Quintana, Elisenda Sanz, Wengang Wang, Granville P. Storey, Ali D. Güler Matthew J. Wanat, Bryan

More information