SUPPLEMENTARY INFORMATION

Size: px

Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Sibyl Hampton
5 years ago
Views:

2 GS 1..8.6 Relative xpression to HPRT set to 1.4.

2 1.2 NNOG 1.8 lizarin red 1x Hematoxylin - osin lizarin red 2x Tolouidine blue lkaline Phosphatase HOHST 2x.6.4.

TTTTGTG IPOQ GTGGTTGTTTGGGG GTTGGTGGGTTGG FP4 TTGGGGTTT GTTGTTGGG HSL TGTGTGTTGTG GGGGGTT LPL TGTGGGTGGGGGTT GGTTTTGGTTTG HPRT TGTGGTG GGTTTTTGGT Y1 TTGGGGGTGTGTTGG GGGTTGG LOVL3 TGTGTTTGG

TGGGGTTGGG Figure S1 erivation and characterization of MPs from hpss.

hpss were differentiated as embryoid bodies (s) in suspension culture.

1 SUPPLMNTRY INFORMTION OI: 1.138/ncb2411 mbryoid ody Formation Pluripotent ells Multipotent Progenitor ells day ispase Formation day 7 replating s day 12 MP p1 day 17 MP p2 day 27 MP p4 mbryoid bodies d7 Replated d12 MP p3 1.2 GS Relative xpression to HPRT set to TX NNOG 1.8 lizarin red 1x Hematoxylin - osin lizarin red 2x Tolouidine blue lkaline Phosphatase HOHST 2x J RIPS pluripotent day 4 MP p MP p1 MP p3 MP p7 F ollagen II -HRP Hematoxylin counterstain Q-PR Target Forward Reverse viral PPRG2 TGGGTGTGGG TTTTGTTGGGTTG PPRG2 GGGGTTGGTTG TGTGTGTGG /P GTGTTTGG TTTTGTG IPOQ GTGGTTGTTTGGGG GTTGGTGGGTTGG FP4 TTGGGGTTT GTTGTTGGG HSL TGTGTGTTGTG GGGGGTT LPL TGTGGGTGGGGGTT GGTTTTGGTTTG HPRT TGTGGTG GGTTTTTGGT Y1 TTGGGGGTGTGTTGG GGGTTGG LOVL3 TGTGTTTGG GGTGGGTTTTT UP1 TTGGGTGG GTTGTTTGTTG PG1 GTTTTTTT TTGGTGGTTTGT TX3 GGTTTTGTGG GTTGGTGGTGT GS GGGGGTGGG TGTGGTTG NNOG TTTGTGGGTGGT GGGTGTTGTGG PRM16 (endo) GGTTTT GGGTTGGGTTT PRM16 (v+e) GGTTTTG TGGGGTTGGG Figure S1 erivation and characterization of MPs from hpss. ) xperimental scheme depicting the timeline and steps necessary to derive mesenchymal progenitor cells (MPs) from human pluripotent stem cells (hpss). hpss were differentiated as embryoid bodies (s) in suspension culture. Formed s were replated on dishes, and outgrowing differentiated cells were passaged several times and were analyzed for expression of mesenchymal surface markers and subsequently used in differentiation experiments. ) rightfield images showing different stages during the derivation of MPs. From left to right: embryoid bodies 7 days after placement of pluripotent cells into suspension culture in ultra-low-attachment dishes; replated embryoid bodies at day 12 (MP passage ) just before cells were passaged; MP passage 3, day 25 after formation, showing a homogenous population of cells with the appearance of fibroblasts. ) qrt- PR characterization of MPs over time. ells were analyzed as hpss, 4 day old s, and after various passages (passage, 1, 3, 7) for the mesendoderm marker GS (top), the mesoderm marker TX (middle) and the pluripotency marker NNOG. (n=3, relative expression to HPRT, largest expression set to 1). ) MPs were differentiated into osteoblasts. To confirm the osteoblast differentiation, the top panel shows from left to right: an alizarin red staining at 1 fold, an alizarin red staining at 2 fold magnification and immunocytochemistry for alkaline phopshatase at 2 fold magnification. ) The chondrocyte differentiation was confirmed by staining sectioned MS microspheres with hematoxylin and eosin (left), tolouidine blue was used to stain glycosaminoglycans (middle) and immunohistochemistry against chondrocyte specific ollagen II (right and bottom). F) List of Oligonucleotides used to perform quantitative RT-PR reactions in this study Macmillan Publishers Limited. ll rights reserved.

SUPPLMNTRY INFORMTION Stro1 29 15 73 44 4 HUS 9 J RiPS HUS 9 J RiPS Figure S2 hps-derived MPs express characteristic mesenchymal stem cell surface markers.

1 MP p11 (light blue), SV p7 (red). The x-axis indicates the relative fluorescent intensity of the indicated antibody from 1 to 1. on a logarithmic scale.

2 SUPPLMNTRY INFORMTION Stro HUS 9 J RiPS HUS 9 J RiPS Figure S2 hps-derived MPs express characteristic mesenchymal stem cell surface markers. ) Flow cytometry for the surface antigens 15, 73, 44, 19 and 4 presented as histograms. HUS 1 p39 (pink), Human Monocytes (dark green), HUS 2 MP p5 (light green), HUS 8 MP p4 (orange), J RiPS #1.1 MP p11 (light blue), SV p7 (red). The x-axis indicates the relative fluorescent intensity of the indicated antibody from 1 to 1. on a logarithmic scale. The y-axis represents the percentage of cells. ) Flow cytometry for the surface antigens Stro1, 15, 73, 44, 29, 4 and unstained controls presented as histograms. J RiPS #1.1p15 (blue), J RiPS #1.1 MP p6 (green), HUS 9 p3 (orange) and p7 (violet) The x-axis indicates the relative fluorescent intensity from 1 to 1. on a logarithmic scale. The y-axis represents the percentage of cells. ) Table showing the results of the two flow cytometry experiments. Numbers represent the percentage of positive cells. If appropriate, positive stainings were distinguished as high or low expression groups. ) Flow nalysis of MP surface antigens. The gating tree was set as follows. Left column: FS/SS (represents the distribution of cells in the light scatter based on size and intracellular composition, respectively) to right column: live gate (P, P-y5, FIT, which represents the fraction of the positive stained cells (Stro1, 29, 15, 73, 44 and 4) Macmillan Publishers Limited. ll rights reserved.

5 15 73 44 Stro1 29 19 4 dipose derived stromal vascular cells dipose derived stromal vascular cells HUS 8 derived mesenchymal progenitor cells HUS 8 derived mesenchymal progenitor cells J RiPS

3 SUPPLMNTRY INFORMTION -3.5 log log Stro dipose derived stromal vascular cells dipose derived stromal vascular cells HUS 8 derived mesenchymal progenitor cells HUS 8 derived mesenchymal progenitor cells J RiPS derived mesenchymal progenitor cells HUS 2 derived mesenchymal progenitor cells HUS 2 derived mesenchymal progenitor cells J RiPS derived mesenchymal progenitor cells one Marrow derived MSs Study 1 one Marrow derived MSs Study 1 one Marrow derived MSs Study 1 HUV confluent HUV confluent HUV sparse HUV sparse mbryonic Stem ells ell line H9 day 1 primitive neural epithelial cells mbryonic Stem ells ell line H9 day 1 neural epithelial cells mbryonic Stem ells ell line H9 day 17 definitive neural epithelial cells mbryonic Stem ells ell line H9 day 17 definitive neural epithelial cells mbryonic Stem ells ell line H9 day 1 primitive neural epithelial cells mbryonic Stem ells ell line H9 day 1 primitive neural epithelial cells mbryonic Stem ells ell line H9 day 1 primitive neural epithelial cells mbryonic Stem ells ell line H9 day 17 definitive neural epithelial cells mbryonic Stem ells ell line H9 day 17 definitive neural epithelial cells mbryonic Stem ells ell line H9 day 17 definitive neural epithelial cells mbryonic Stem ells ell line H9 day 17 definitive neural epithelial cells mbryonic Stem ells ell line H9 day 1 neural epithelial cells mbryonic Stem ells ell line H9 day 6 embryoid body mbryonic Stem ells ell line H9 day 6 embryoid body mbryonic Stem ells ell line H9 day 6 embryoid body mbryonic Stem ells ell line H9 mbryonic Stem ells ell line H9 mbryonic Stem ells ell line H9 Stroma normal breast tissue Stroma normal breast tissue Stroma normal breast tissue Stroma normal breast tissue Stroma normal breast tissue HUS 8 derived mesenchymal progenitor cells HUS 8 derived mesenchymal progenitor cells HUS 2 derived mesenchymal progenitor cells HUS 2 derived mesenchymal progenitor cells J RiPS derived mesenchymal progenitor cells J RiPS derived mesenchymal progenitor cells dipose derived stromal vascular cells dipose derived stromal vascular cells one Marrow derived MSs Study 1 one Marrow derived MSs Study 1 one Marrow derived MSs Study 1 Figure S3 hps-derived MPs display a global transcriptional profile similar to mesenchymal stem or progenitor cells. GO entries on the ffymetrix Human Genome U133 Plus 2. platform were selected randomly from a pool of entries that contained the key words MSs and hss along with several studies focused on various tissue and cell types. ll array data was processed and normalized using the RM feature in the ioconductor affy package in R. Probesets were mapped to and median collapsed onto HUGO gene symbol identifiers and median centered by array. ) Unsupervised hierarchical clustering and heatmap across all represented genes and all arrays acquired from GO. Genes are rows; conditions are columns. Genes are colored according to probe intensity, with blue denoting lower than the median expression, and red denoting higher than the median expression. ) lose up of the array tree cluster in. ) rray clustering and heatmap of the MS subset of arrays from and with the flow cytometry markers which are represented characteristic for a mesenchymal stem cell fate Macmillan Publishers Limited. ll rights reserved.

SUPPLMNTRY INFORMTION SV 1 - PPRγ differentiation SV 1 control differentiation SV 2 - PPRγ differentiation SV 2 control differentiation Pluripotent ells 73+ ells Immature dipocytes Mature dipocytes d

-) Two distinct SV lines were differentiated for 21 days (16 days with doxycycline followed by 5 days without doxycycline).

4 SUPPLMNTRY INFORMTION SV 1 - PPRγ differentiation SV 1 control differentiation SV 2 - PPRγ differentiation SV 2 control differentiation Pluripotent ells 73+ ells Immature dipocytes Mature dipocytes d d6 d16 d35 +ox -ox rightfield HOHST PPRG2 P OIPY Figure S4 Programming with PPRG2 reduces variation of SV differentiation and allows long-term culture of hps-derived after doxycycline withdrawal. -) Two distinct SV lines were differentiated for 21 days (16 days with doxycycline followed by 5 days without doxycycline). oth lines were either untransduced (un) or transduced () with Lenti- PPRG and Lenti-rtT. xperiments were conducted in biological triplicates. Shown are representative images of Oil-Red-O stained. From top to bottom: ) cells; ) un control cells; ) cells; F) un control cells. ) In vitro programming of hpss into. PPRG2- s were differentiated with adipogenic media in the presence of doxycycline for 16 days, followed by an additional 2 days of differentiation in the absence of doxycycline. Top panel left: brightfield image showing the morphology of the differentiated mature. Top panel right: staining with HOHST dye. ottom panel left: Immunostaining for P (red). ottom panel right: Neutral lipid using OIPY dye (green) Macmillan Publishers Limited. ll rights reserved.

PRM16 SUPPLMNTRY INFORMTION i ii P Relative xpression to HPRT iii RN copy number: 7.5x 1 7 copies/ml ~ 1.5x1 8 copies/ml 3. 5.

2 untransduced PPRG2 PPRG2-PRM16 - OX + OX P-PRM16 PPRG2- P-PRM16 PPRG2-P Figure S5 fficient transduction of hps-derived MPs with inducible lentiviral PPRG2 and P programs a brown adipocyte fate.

ells were induced with doxycyline for 48 hours, and GFP fluorescence pictures were acquired using fixedexposure settings.

5 PRM16 SUPPLMNTRY INFORMTION i ii P Relative xpression to HPRT iii RN copy number: 7.5x 1 7 copies/ml ~ 1.5x1 8 copies/ml Picture Volume rtt Volume GFP i 5 μl 5 μl ii 5 μl 25 μl iii 5 μl 125 μl iv 5 μl 66 μl ells counted GFP + cells % positive cells ST. viral PPRG2 PPRG rtt control 48h PT -OX h PT +OX d PT/ 5d -OX 3.58 iv Relative xpression to HPRT normalized to UP IPONTIN I untransduced PPRG2 PPRG2-PRM16 - OX + OX P-PRM16 PPRG2- P-PRM16 PPRG2-P Figure S5 fficient transduction of hps-derived MPs with inducible lentiviral PPRG2 and P programs a brown adipocyte fate. ) In one well of a 12-well dish, approximately 5, s were transduced with a fixed volume of Lenti-rtT viral supernatant and declining volumes of Lenti-GFP viral supernatant. ells were induced with doxycyline for 48 hours, and GFP fluorescence pictures were acquired using fixedexposure settings. The viral copy number for the Lenti-GFP virus in the supernatants of virus preparations was determined using the Lenti-X qrt- PR method (S). ) Using 5 μl of Lenti-rtT and 5 μl of Lenti-GFP viral supernatants, 5, s plated in wells of a 12-well dish were transduced and exposed to doxycyline for 48 hours. Percentages of GFP-positive cells were determined by counting cells from three independent experiments (S). ) oxycycline-inducible expression of PPRG2. Quantitative RT-PR for viral PPRG2 cn expression normalized to endogenous PPRG expression, except for primary fat for which endogenous PPRG expression normalized to HPRT is shown. From left to right: J RiPS MPs transduced with Lenti-rtT only (control); s transduced with Lenti-rtT and Lenti-PPRG2 cultured in the absence ( OX) or presence (+OX) of doxycycline for 48 hours; s transduced with Lenti-rtT and Lenti-PPRG2 and differentiated for 16 days with doxycycline followed by 5 days without doxycycline; primary fat (S). ) MPs were transduced with Lenti-rtT and Lenti-PRM16 (top panel), or Lenti-rtT and Lenti-P (bottom panel) respectively. The cells were either left untreated (left panel) or exposed to 7 ng/ml of doxycycline for 48h (right panel). Immunostaining was performed using the antibodies against PRM16 or P. (1x magnification) ) ombinations of Lenti-PPRG2, lenti-p and PRM16 were screened for the potential to induce brown fat differentiation. The cells were differentiated for 21 days (14 days with doxycycline followed by 7 days without doxycycline). Shown are the result of subsequent quantitative RT-PR toward UP1 as a brown adipocyte marker, IPONTIN and I, both adipocyte markers. P values in the bar graphs represent two-tailed Student t-tests between the various conditions and un expression values. (n=3, relative expression to HPRT, normalized to 1, *P <.5; P <.1 (S)) Macmillan Publishers Limited. ll rights reserved.

SUPPLMNTRY INFORMTION PPRG PPRG -7.5 log2 7.

with a brown adipocyte fate. ) ffymetix 1.

ST microarrays. Shown is a heatmap of hierarchical clustering performed on the 2,136 differentially expressed genes at a 5% false discovery rate. Genes are rows; conditions are columns.

) gilent G G3 microarray: Global transcriptional profiling of PPRG-.

Shown here is unsupervised hierarchical clustering and heatmap across all probes above background on arrays. Genes are rows; conditions are columns.

6 SUPPLMNTRY INFORMTION PPRG PPRG -7.5 log2 7.5 PPRG -8 log2 1 PPRG -8 log2 1 PPRG -6 log2 6 P P P PP PP PP P P PP PP PP P PPRG PPRG-P PPRG-P-PRM16-6 log2 6 Figure S6 PPRG2-P and PPRG2-P-PRM16 exhibit global transcriptional profiles consistent with a brown adipocyte fate. ) ffymetix 1. ST microarrays: SVs, s, and s either not exposed to adipogenic media () or cultured with adipogenic media and transduced with lenti-pprg (+PPRG) were compared to primary using ffymetix 1. ST microarrays. Shown is a heatmap of hierarchical clustering performed on the 2,136 differentially expressed genes at a 5% false discovery rate. Genes are rows; conditions are columns. Genes are colored according to average expression level across all samples, with blue denoting lower expression, and red denoting higher expression. ) gilent G G3 microarray: Global transcriptional profiling of PPRG-. SVs, s, and J RiPS MPs either not exposed to adipogenic media () or cultured with adipogenic media and transduced with lenti-pprg (+PPRG) were compared to primary gilent G G3 microarrays. Shown here is unsupervised hierarchical clustering and heatmap across all probes above background on arrays. Genes are rows; conditions are columns. Genes are colored according to probe intensity, with blue denoting lower than the median expression, and red denoting higher than the median expression. ) Heatmap of hierarchical clustering performed on the 4,74 differentially expressed genes at a 5% false discovery rate. Genes are rows; conditions are columns. Genes are colored according to probe intensity with blue denoting lower than the median expression, and red denoting higher than the median expression. ) Row centered heatmap of hierarchical clustering performed on the 4,74 differentially expressed genes at a 5% false discovery rate. Genes are rows; conditions are columns. Genes are colored according to average expression level across all samples, with blue denoting lower expression, and red denoting higher expression. ) Global transcriptional profiling of (PPRG2)-, (PPRG2-P) or (PPRG2-P-PRM16). SVs, s, and s either not exposed to adipogenic media () or cultured with adipogenic media and transduced with lenti-pprg2 (+PPRG2), (PPRG2-P) or (PPRG2-P- PRM16) were compared to primary using the gilent G3 Human G microarray platform. Shown is a row centered heatmap of hierarchical clustering performed on the 2,136 differentially expressed genes at a 1% false discovery rate. Probe sets are colored according to average expression level across all samples, with blue denoting lower expression, and red denoting higher expression Macmillan Publishers Limited. ll rights reserved.

7 SUPPLMNTRY INFORMTION un 5 42: TG 44:2 TG 44:1 TG 44: TG 46:4 TG 46:3 TG 46:2 TG 46:1 TG 46: TG 48:5 TG 48:4 TG 48:3 TG 48:2 TG 48:1 TG 48: TG 5:6 TG 5:5 TG 5:4 TG 5:3 TG 5:2 TG 5:1 TG 5: TG 52:7 TG 52:6 TG 52:5 TG 52:4 TG 52:3 TG 52:2 TG 52:1 TG 52: TG 54:8 TG 54:7 TG 54:6 TG 54:5 TG 54:4 TG 54:3 TG 54:2 TG 54:1 TG 56:9 TG 56:8 TG 56:7 TG 56:6 TG 56:5 TG 56:4 TG 56:3 TG 56:2 TG 58:12 TG 58:11 TG 58:1 TG 58:9 TG 58:8 TG 58:7 TG 58:6 TG 6:12 TG 6:11 TG un 5 42: TG 44:2 TG 44:1 TG 44: TG 46:4 TG 46:3 TG 46:2 TG 46:1 TG 46: TG 48:5 TG 48:4 TG 48:3 TG 48:2 TG 48:1 TG 48: TG 5:6 TG 5:5 TG 5:4 TG 5:3 TG 5:2 TG 5:1 TG 5: TG 52:7 TG 52:6 TG 52:5 TG 52:4 TG 52:3 TG 52:2 TG 52:1 TG 52: TG 54:8 TG 54:7 TG 54:6 TG 54:5 TG 54:4 TG 54:3 TG 54:2 TG 54:1 TG 56:9 TG 56:8 TG 56:7 TG 56:6 TG 56:5 TG 56:4 TG 56:3 TG 56:2 TG 58:12 TG 58:11 TG 58:1 TG 58:9 TG 58:8 TG 58:7 TG 58:6 TG 6:12 TG 6:11 TG 25 SV un 5 42: TG 44:2 TG 44:1 TG 44: TG 46:4 TG 46:3 TG 46:2 TG 46:1 TG 46: TG 48:5 TG 48:4 TG 48:3 TG 48:2 TG 48:1 TG 48: TG 5:6 TG 5:5 TG 5:4 TG 5:3 TG 5:2 TG 5:1 TG 5: TG 52:7 TG 52:6 TG 52:5 TG 52:4 TG 52:3 TG 52:2 TG 52:1 TG 52: TG 54:8 TG 54:7 TG 54:6 TG 54:5 TG 54:4 TG 54:3 TG 54:2 TG 54:1 TG 56:9 TG 56:8 TG 56:7 TG 56:6 TG 56:5 TG 56:4 TG 56:3 TG 56:2 TG 58:12 TG 58:11 TG 58:1 TG 58:9 TG 58:8 TG 58:7 TG 58:6 TG 6:12 TG 6:11 TG un un SV un 32:2 G 32:1 G 34:2 G 34:1 G 36:3 G 36:2 G 36:1 G 32:2 G 32:1 G 34:2 G 34:1 G 36:3 G 36:2 G 36:1 G 32:2 G 32:1 G 34:2 G 34:1 G 36:3 G 36:2 G 36:1 G un un SV un :1 LP 16: LP 18:2 LP 18:1 LP 18: LP 2:4 LP 22:6 LP 16:1 LP 16: LP 18:2 LP 18:1 LP 18: LP 2:4 LP 22:6 LP 16:1 LP 16: LP 18:2 LP 18:1 LP 18: LP 2:4 LP 22:6 LP Figure S7 PPRG2- white lipid profiles resemble primary white adipose tissue. Lipidomic profiling of SV- and hpsderived. The cellular lipid content of SVs, s, and s into with PPRG2 was analyzed using a tandem mass spectroscopy lipidomics platform and compared to primary adipose tissue. Shown are the relative abundances of several long-chain triacylglyceride species in each cell type. The x-axis denotes the total number of carbon atoms in the fatty-acid chains:unsaturated bonds. The y-axis represents the relative abundance of each lipid analyte. are the most abundant triacylglycerides, of a size range between 42: to 6:11. are diacylglycerides of a size range between 32:2 to 36:1. are lysophosphatidylcholine lipids, part of the membrane lipids present in all cells. The displayed size range is between 16:1 and 22: Macmillan Publishers Limited. ll rights reserved.

Human Primary Fat Primary Mouse rown Fat SUPPLMNTRY INFORMTION 4.5 4. HSL PPRG 3.75 3. 29.25 P 16.75 p = 2*1-16 16. 15.25 3.5 3. 2.5 2. 3.75 3.75 3. 3. 2.25 2.25 1.5 1.5.75.75.. FP4 IPOQ -16 152 5,85 p = 2*1 p = 2.

5 3. 2.5 2.5 2. 1.5 1..5 * 1 8 6 4 2 * 2. 1.5 1..5. -PPRG +PPRG HUS 8 MP J RiPS [2] MP HUS 8 MP J RiPS [2] HUS 8 MP J RiPS [1] MP J RiPS [2] MP -PPRG +PPRG HUS 8 MP J RiPS [2] MP HUS 8 MP J RiPS [2] HUS 8 MP J RiPS [1] MP J RiPS [2] MP.

8 Human Primary Fat Primary Mouse rown Fat SUPPLMNTRY INFORMTION HSL PPRG P p = 2* FP4 IPOQ ,85 p = 2*1 p = 2.2* , ,55 3,9 4 3, ,6 1, ,3 16 * 65 8 HSL LPL 14.5 p = 4.3* p = 2.2* * * * Relative xpression to HPRT d2 set to IPOQ FP * * PPRG +PPRG HUS 8 MP J RiPS [2] MP HUS 8 MP J RiPS [2] HUS 8 MP J RiPS [1] MP J RiPS [2] MP -PPRG +PPRG HUS 8 MP J RiPS [2] MP HUS 8 MP J RiPS [2] HUS 8 MP J RiPS [1] MP J RiPS [2] MP. d2 d4 d8 d12 d16 oxycyline withdrawal 3 Leptin Release + PPRG Glycerol Release untransduced (control) PPRG2-P PPRG2-P-PRM16 Lepin [pg/ml] Glycerol/Protein [control set to 1] * 5 5. HUS 8 MP J RiPS MP HUS 9 MP. -iso +iso -iso +iso -iso +iso i F Pluripotent ells MPs rown dipocytes day - d d5 d16 d25 +ox -ox Primary Mouse iirown Fat iii HOHST M1281 HOHST (Human Nuclei) M1281 (Human Nuclei) rightfield UP1 HOHST UP1 rightfield 2x 4x (1.5 digital zoom) Relative xpression to HPRT d5 (untransdcued) set to 1 4. PRM16 (endogenous transcript) PRM16 (viral+endogenous transcript) J RiPS #1.1 p1 MP p6 day - day 5 day 5 day 5 day 25 day 25 day 25 Pluripotent ells untransduced PPRG2-P PPRG2-P-PRM16 Figure S8 dditional transcriptional and functional characterization of hps-derived. ) Quantitative RT-PR analysis of the expression of adipogenic marker genes: PPRG, P, FP4, IPOQ, HSL, and LPL. The data represent three biological replicates and are shown as relative expression to the housekeeping gene HPRT. Shown in yellow are un, control cells. Shown in green are un, differentiated cell lines. Shown in red are, differentiated cell lines. Shown in blue and, in some graphs, on a separate scale are gene expression levels in primary fat obtained from the pannus of a patient who underwent elective surgery. P values in the bar graphs represent two-tailed Student t-tests between and un expression values for each cell line. n=3 *P <.5; P <.1 (S). P values shown under each gene name represent NOV analyses among all expression values for the and un cell lines. ) hps-derived MPs were transduced with PPRG2 and adipogenic differentiation was initiated through administration of doxycycline in adipogenic medium. oxycycline was withdrawn at indicated time points (X-axis). ll cells were differentiated until day 21. qrt-pr was performed for adipocyte marker genes HSL, IPOQ, FP4. xpression values represent two biological replicates and are shown as relative to HPRT expression in each sample. Relative expression was set to 1 (S). ) Leptin release assay: nzyme-linked immunosorbent assay (LIS) for leptin in the supernatant of hps-derived PPRG2 exposed to adipogenic media, ) Glycerol Release after Isopreterenol exposure: hps-derived brown respond to Isopreterenol by releasing glycerol from the cells. Glycerol was measured in J RiPS-derived MPs that were differentiated with adipogenic media alone (untransduced, white bars), with expression of a combination of (PPRG2-P) (light grey bars) or (PPRG2-P-PRM16) (dark grey bars). The cells were measured at basal level (-iso) and after exposure to Isopreterenol (+iso). The quantity of released glycerol (in μg) was normalized to the total amount of protein (in mg) for each sample (n = 6 Student s t-test P <.1 (SM)). ) Immunostaining of primary mouse brown adipose tissue and human adipose tissue: i) Mouse interscapular T were used as M1281 negative and UP1 positive control. (pictures taken using confocal,microscopy, with 4 fold magnification + confocal digital zoom). ii) rightfield picture (left), UP1 immunostain (middle) and overlay of UP1 and HOHST stain of primary mouse T (magnification 2x). iii) rightfield morphology of human primary fat. (magnification 2x) F) Quantitative RT-PR analysis for the expression of PRM16 in pluripotent cells (black), untransduced MPs (white) or with expression of a combination of (PPRG2-P) (light grey bars) or (PPRG2-P-PRM16) (dark grey bars). ells were collected at day 5 (under exposure to doxycycline) and day 25 (doxycycline withdrawn from media) and expression was measured using oligos detecting only endogenous expressed PRM16 (top) and with oligos detecting endogenous and viral expression. The data is shown as relative expression to the housekeeping gene HPRT, with the untransduced control set as Macmillan Publishers Limited. ll rights reserved.

SUPPLMNTRY INFORMTION Figure S9 Western blot analysis of insulin signaling of hps-derived white.

(FF) alone, or both. ) Western membrane was incubated with Ser-473 phosphorylated KT antibody.

) Western membrane was incubated with total KT. ) Lamin / was used as a loading control.

9 SUPPLMNTRY INFORMTION Figure S9 Western blot analysis of insulin signaling of hps-derived white. The human pluripotent stem cells (hpss)-derived were incubated with insulin alone, free fatty acid mixture (FF) alone, or both. ) Western membrane was incubated with Ser-473 phosphorylated KT antibody. While insulin induced Ser-473 phosphorylation on KT, FF treatment attenuated insulin signaling. ) Western membrane was incubated with total KT. ) Lamin / was used as a loading control. Protein bands corresponding antibodies indicated in the square boxes of the original blots Macmillan Publishers Limited. ll rights reserved.

10 SUPPLMNTRY INFORMTION Supplemental ata Table 1 Worksheet 1: VI GO term analysis for genes up-regulated in PPRG2 and primary over cells in ffymetrix data. Worksheet 2: VI GO term analysis for genes down-regulated in PPRG2 and primary cells in ffymetrix data. Worksheet 3: VI GO term analysis for genes up-regulated in primary over PPRG2 samples in ffymetrix data. Worksheet 4: VI GO term analysis for genes up-regulated in PPRG2 samples over primary samples in ffymetrix data. Supplemental ata Table 2 Work sheet 1: SM output for all genes when testing PPRG2 and primary against all samples for ffymetrix data and Work sheet 2: gilent data. Worksheet 3: SM output for all genes when testing primary against PPRG2 samples for ffymetrix and Worksheet4: gilent data Macmillan Publishers Limited. ll rights reserved.

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG