Ovariectomy (OVX) surgery was performed via dorsal route on 3-week-old mice (1).

Size: px

Start display at page:

Download "Ovariectomy (OVX) surgery was performed via dorsal route on 3-week-old mice (1)."

Abner Hudson
5 years ago
Views:

1 Supplementary Material Animals Mice were housed in specific pathogen free facility with 12 h light/dark cycles. Commercial rodent standard chow and tap water were available ad libitum unless noted. For diet-induced obesity, 6-week-old FC and MRKO mice were placed on a high-fat diet (HFD, D12492, Research Diets Inc.) or normal control diet (ND, D12450B, Research Diets Inc.) for 18 weeks. GTT and ITT were conducted at the age of 22-week-old and 23-week-old respectively. Body composition was measured by a mini-spec nuclear magnetic resonance spectrometer (Bruker Corporation) following the manufacturer s instructions. Body weights were monitored weekly. To monitor food intake, each mouse was housed separately and food was weighed every 3 days for 2 weeks. Food intake of each mouse was presented as total food consumption divided by total days of monitoring. Ovariectomy (OVX) surgery was performed via dorsal route on 3-week-old mice (1). Depletion of Monocytes/Macrophages To deplete monocytes/macrophages, 300 μl of control liposomes or Clophosome-A clodronate liposomes (FormuMax) were injected into mice via tail vein every 4 days following the manufacturer s instructions. Immunohistochemistry with anti-cd68 antibodies (MCA1957GA; AbD Serotec) was performed to verify the efficiency of Kupffer cell depletion in the liver. Histology BODIPY staining was performed via incubation with BODIPY 493/503 (Life Technologies) for 15min in dark. Nuclei were stained with Hoechst Photographs were acquired by Zeiss confocal microscope (LSM510), Olympus confocal microscope (FV1000), or Olympus microscope (BX53). For immunofluorescence, the whole pancreas from each mouse was sectioned (5 μm) at intervals of 200 μm and paraffin sections were prepared for subsequent staining as we reported (2). The images were further analyzed using Image J software (National Institutes of Health, Bethesda, MD). The percentage of islet area per total pancreatic area was calculated (3). Immunocytochemistry of cells was performed as previously reported (2), and the primary antibodies used were against mouse CD68 (MCA1957GA; AbD Serotec), HGF (MA ; Thermo Fisher Scientific) and FLAG (F3165; Sigma-Aldrich). Non-parenchymal Cell (NPC) Isolation Liver NPCs were isolated as previously reported (4). Briefly, hepatocytes were removed by three times of centrifugation at 50g for 2 min. Then liver NPCs were obtained by centrifugation of the supernatant at 500g for 10 min followed by removal of red blood cells with RBC lysis buffer.

2 Neutrophil Isolation Mouse bone marrow-derived neutrophils were isolated as previously described (5, 6). Production of ERα Overexpression (EROV) Lentivirus Full length mouse Esr1 coding region was amplified from mouse cdna and subcloned into phagefef1a-ires-zsgreen vector for subsequent transfection and lentivirus package. Purified lentivirus was used for KC transfection.

Supplementary Figure S1. Comparable Characteristics between Female FC-ob and MRKO-ob mice. (A) Body weight, (B) body composition, and (C) food intake of female FC, MRKO, FC-ob, and MRKO-ob mice.

(E) Quantification of islet areas of female mice as shown in (D). (F) Plasma FFAs of female mice.

3 Supplementary Figure S1. Comparable Characteristics between Female FC-ob and MRKO-ob mice. (A) Body weight, (B) body composition, and (C) food intake of female FC, MRKO, FC-ob, and MRKO-ob mice. (D) Pancreas images of female FC, MRKO, FC-ob, and MRKO-ob mice. Islets were stained with anti-insulin antibody (green). Scale bar: 1000 μm. (E) Quantification of islet areas of female mice as shown in (D). (F) Plasma FFAs of female mice. (G) Immunoblotting analysis of p-ir, T- IR, p-akt, and T-Akt in uterine adipose tissues of female FC, MRKO, FC-ob, and MRKO-ob mice before (-) and after (+) insulin injection. ins: insulin. (H) Quantification of p-ir/t-ir (left panel) and p- Akt/T-Akt (right panel) in uterine adipose tissues. (I) Immunoblotting analysis of p-ir, T-IR, p-akt, and T-Akt in skeletal muscle of female FC, MRKO, FC-ob, and MRKO-ob mice before (-) and after (+) insulin injection. ins: insulin. (J) Quantification of p-ir/t-ir (left panel) and p-akt/t-akt (right panel) in skeletal muscle. For all panels except (D), (G), or (I), data are presented as mean ± SEM representing n=6-8 mice per group. n.s., not significant; *P<0.05; **P<0.01; ***P<0.001.

in Insulin Sensitivity or Glucose Homeostasis.

of GTT, (D) ITT, (E) AUC of ITT, (F) plasma

composition, and (I) food intake of male FC,

4 Supplementary Figure S2. Male MRKO-ob Mice Do Not Manifest Improvement in Insulin Sensitivity or Glucose Homeostasis. (A) Random-fed blood glucose, (B) GTT, (C) AUC of GTT, (D) ITT, (E) AUC of ITT, (F) plasma insulin levels, (G) body weight, (H) body composition, and (I) food intake of male FC, MRKO, FC-ob and MRKO-ob mice. n=7-12. n.s., not significant; **P<0.01; ***P<0.001.

5 Supplementary Figure S3. Effects of Myeloid MRKO on Obesity, Glucose Intolerance and Insulin Resistance in HFD-Induced Male Mice. (A) Body weight, (B) random-fed blood glucose, (C) GTT, and (D) ITT of male FC and MRKO mice fed normal control diet (ND) or high-fat diet (HFD) (n=5-6 per group). n.s., not significant.

concentration of male FC-ob and MRKO-ob mice implanted with placebo (Pl) or

6 Supplementary Figure S4. Concentrations of Sex Hormones in Male Obese Mice. (A) Plasma 17β-estradiol, (B) dihydrotestosterone (DHT), and (C) testosterone concentration of male FC-ob and MRKO-ob mice implanted with placebo (Pl) or estrogen (E 2 ) (n=5-7 per group). n.s., not significant; **P<0.01; ***P<0.001.

Mice. (A) Plasma 17β-estradiol concentration of female mice with or without ovariectomy (OVX) surgery (n=6-8 per

7 Supplementary Figure S5. Effects of Myeloid MRKO on Obesity, Glucose Intolerance and Insulin Resistance in Ovariectomized Female ob/ob Mice. (A) Plasma 17β-estradiol concentration of female mice with or without ovariectomy (OVX) surgery (n=6-8 per group). (B) Body weight, (C) random-fed blood glucose, (D) GTT, and (E) ITT of ovariectomized female FC-ob and MRKO-ob mice (n=6-8 per group). ND, not detectable. n.s., not significant; **P<0.01; ***P<0.001.

triglycerides of male FC, MRKO, FCob, and MRKO-ob mice (n=7-12

(C) LW/BW of male FC and MRKO mice fed ND or HFD (n=5-6 (D)

8 Supplementary Figure S6. Effects of Myeloid MRKO on Hepatic Steatosis in Male or Ovariectomized Female ob/ob Mice. (A) Liver weight to body weight ratio (LW/BW) and (B) hepatic triglycerides of male FC, MRKO, FCob, and MRKO-ob mice (n=7-12 per group). (C) LW/BW of male FC and MRKO mice fed ND or HFD (n=5-6 per group). (D) LW/BW, (E) H&E staining of livers, and (F) hepatic triglycerides of ovariectomized female FC-ob and MRKO-ob mice (n=6-8 per group). Scale bar: 500 μm. n.s., not significant; *P<0.05; ***P<0.001.

(B) Lipidomic analysis showing total contents of phosphatidic acid (PA), phosphatidylglycerol (PG), and ceramide in livers from female mice.

9 Supplementary Figure S7. Levels of Phospholipids and Fatty Acids in Livers of Female Mice. (A) Lipidomic analysis showing total contents of phosphatidylcholine (PC) and phosphatidylethanolamine (PE) in livers from female FC, MRKO, FC-ob, MRKO-ob mice. (B) Lipidomic analysis showing total contents of phosphatidic acid (PA), phosphatidylglycerol (PG), and ceramide in livers from female mice. (C) Lipidomic analysis showing total contents of phosphatidylinositol (PI), phosphatidylserine (PS), lysophosphatidylcholine (LPC), and sphingomyelin (SM) in female livers. (D) Quantification of hepatic total fatty acids in female mice (n=4 per group). Total lipids extracted from liver tissues were measured by gas chromatography-mass spectrometry (GC- MS)-based profiling. (E) Quantification of fatty acid (16:0, also called palmitic acid) in female livers. (F) Quantification of fatty acid (16:1n9) in female livers. n=4. n.s., not significant; *P<0.05; **P<0.01; ***P<0.001.

female FC, MRKO, FC-ob, and MRKO-ob mice (n=8).

10 Supplementary Figure S8. Hepatic Gene Expression of Female Mice. (A) qrt-pcr analysis of genes related to β-oxidation in liver samples from female FC, MRKO, FC-ob, and MRKO-ob mice (n=8). (B) qrt-pcr analysis of inflammatory genes in liver samples from female mice (n=8). n.s., not significant; *P<0.05; ***P<0.001.

of FC-ob mice injected with control liposome or clodronate

(B) GTT, (C) ITT, (D) plasma insulin levels, (E) LW/BW, (F)

11 Supplementary Figure S9. Clodronate Liposomes Abolishes The Metabolic Protection of MRKO In Female Obese Mice. (A) Immunohistochemical staining of CD68 in liver sections of FC-ob mice injected with control liposome or clodronate liposome. Scale bar: 500 μm. (B) GTT, (C) ITT, (D) plasma insulin levels, (E) LW/BW, (F) hepatic H&E staining, and (G) hepatic triglycerides of FC-ob mice and MRKO-ob mice injected with clodronate liposomes (Clo). Scale bars: 500 μm. n.s., not significant.

Supplementary Figure S10. MR Deficiency in Kupffer Cells Reduces Lipid Accumulation in Hepatocytes.

Hoechst 33342 was used to stain nuclei. More than 90% of the cells were CD68-positive KCs. (b) Close-up image of a KC.

(B) Immunofluorescence staining of hepatocyte-kc co-culture system in the presence of FFAs. BODIPY 493/503 indicates lipid droplets. Scale bar: 50 μm.

(D) Genotyping for MRKO allele using genomic DNA from FCKCs and KOKCs as template. KO band: 390 bp; Floxed band: 335 bp.

12 Supplementary Figure S10. MR Deficiency in Kupffer Cells Reduces Lipid Accumulation in Hepatocytes. (A) Immunofluorescence staining of Kupffer cells (KCs) in culture. Anti-CD68 antibody was used to stain KCs 2 days after adherence (a). Hoechst was used to stain nuclei. More than 90% of the cells were CD68-positive KCs. (b) Close-up image of a KC. (c) Negative control with primary antibody omitted in immunofluorescence staining. Scale bar: 250 μm (A-a and c); 30 μm (A-b). (B) Immunofluorescence staining of hepatocyte-kc co-culture system in the presence of FFAs. BODIPY 493/503 indicates lipid droplets. Scale bar: 50 μm. (C) Lipid accumulation of primary hepatocytes in the absence (-) or presence (+) of KCs. (D) Genotyping for MRKO allele using genomic DNA from FCKCs and KOKCs as template. KO band: 390 bp; Floxed band: 335 bp. (E) qrt-pcr analysis of Nr3c2 (encoding MR) expression in KCs isolated from FC and MRKO mice. (F) Immunoblotting analysis of MR in KCs. (G) Immunofluorescence staining of hepatocytes (Hep) co-cultured with FCKCs or KOKCs in the presence of FFAs and E 2. Intracellular lipid droplets were labeled with BODIPY 493/503 (green) and nuclei with Hoechst Scale bar: 50 μm. Data represent three independent experiments. *P<0.05; **P<0.01; ***P<0.001.

(C) qrt-pcr analysis of Esr1 (encoding ER ) expression in KCs infected with scrambled adenovirus (AdshScr) or ER -specific adenovirus (AdshER.

13 Supplementary Figure S11. ER Regulates HGF Secretion in KCs. (A) Immunofluorescence staining of CD68 and HGF in isolated KCs. Scale bar: 100 μm. (B) ELISA analysis of HGF in supernatants of adherent non-parenchymal cells isolated from livers of mice injected with or without clodronate liposomes (Clo). (C) qrt-pcr analysis of Esr1 (encoding ER ) expression in KCs infected with scrambled adenovirus (AdshScr) or ER -specific adenovirus (AdshER. (D) ELISA analysis of HGF in supernatants of KCs with or without ER knockdown. (E) qrt-pcr analysis of Esr1 expression in KCs infected with control (Ctrl) or ER overexpression (EROV) lentiviruses. (F) ELISA analysis of HGF in supernatants of KCs with or without ER overexpression. All cells were cultured with the presence of E 2. Data represent three independent experiments. n.s., not significant; *P<0.05; **P<0.01; ***P<0.001.

Supplementary Figure S12. Verification of MROV RAW264.

MR. (A) qrt-pcr analysis of Nr3c2 (encoding MR) expression in

14 Supplementary Figure S12. Verification of MROV RAW264.7 Cell Line and Characterization of Subcellular Distribution of MR. (A) qrt-pcr analysis of Nr3c2 (encoding MR) expression in stable MR overexpression (MROV) and control (Ctrl) RAW264.7 cells. (B) Immunoblotting analysis of FLAG and MR protein expression in stable MROV and control (Ctrl) RAW264.7 cells. (C) Immunofluorescence staining of MR using antibody against FLAG in HEK293FT cells transiently transfected with MR-flag expression plasmid. Scale bar: 50 μm.

15 Supplementary Figure S13. Verification of Met Knockdown in Mouse Livers. Immunoblotting analysis of p-met and T-Met in livers from female FC-ob and MRKO-ob mice injected with adenovirus (AdshScr or AdshMet) before (-) and after (+) insulin injection. ins: insulin. AdshScr AdshMet ins p-met T-Met -tubulin FCob MRKOob FCob MRKOob KD 145KD 52KD

16 Supplementary Table S1. Primer Sequences for Amplifying Truncated Mouse Esr1 Promoters Name Forward Reverse 2kb Esr1-luc 5 -ATCGGGTACCATTCGATAGG 5 -ATCGAAGCTTTACCTGCTTG 1.4kb Esr1-luc 5 -ATCGGGTACCGAAAACTGAAG same as above 1.2kb Esr1-luc 5 -ATCGGGTACCTGATACCATT same as above 0.44kb Esr1-luc 5 -ATCGGGTACCCAGAAAGAAC same as above 0.38kb Esr1-luc 5 -ATCGGGTACCTATTGCAAGG same as above 5 Esr1-luc 5 -TTTTTTTTCAGCCAGAGGCTTGTCC 5 -AACCCACTTTCTCTTTCCTTGCAAT 4+ 5 Esr1-luc same as above 5 - CTTGGAAAAAATAAAATAAGGGAGC

17 Supplementary Table S2. Primer Sequences for PCR Analysis of ChIP Products Name Forward Reverse Esr1 Region 1 5 -TGGCAAGTAACAGAGGGATTCAA 5 -AGAAGGCCCTCGCTTTATTGTT Esr1 Region 2 5 -TGTTTTGGGGCCAAACTCACC 5 -CATCTCAGAATTGGCTGAGAGGA Esr1 Region 3 5 -TGGTCTTTTGCCTGATACCATTC 5 -GTGTTTTAAATGCTGGGTTGTTGT Esr1 Region 4 5 -ATCTGTGTGCAGAAAGAACGC 5 -AAGTGATCCAACCCACTTTCTCT Esr1 Region 5 5 -GTTCGTCTAGACTTCGAGCTT 5 -CTGCTTCCAACTTTCTCAGCG Sgk1 promoter 5 -AACTGGGCAACTGCTTCATC 5 -GCCTTTGTCGGAAAAACATC

18 Supplementary References 1. Strom JO, Theodorsson A, Ingberg E, Isaksson IM, Theodorsson E: Ovariectomy and 17beta-estradiol replacement in rats and mice: a visual demonstration. Journal of visualized experiments : JoVE 2012:e Sun JY, Li C, Shen ZX, Zhang WC, Ai TJ, Du LJ, Zhang YY, Yao GF, Liu Y, Sun S, Naray-Fejes- Toth A, Fejes-Toth G, Peng Y, Chen M, Liu X, Tao J, Zhou B, Yu Y, Guo F, Du J, Duan SZ: Mineralocorticoid Receptor Deficiency in Macrophages Inhibits Neointimal Hyperplasia and Suppresses Macrophage Inflammation Through SGK1-AP1/NF-kappaB Pathways. Arteriosclerosis, thrombosis, and vascular biology 2016;36: Velazquez-Garcia S, Valle S, Rosa TC, Takane KK, Demirci C, Alvarez-Perez JC, Mellado-Gil JM, Ernst S, Scott DK, Vasavada RC, Alonso LC, Garcia-Ocana A: Activation of protein kinase C-zeta in pancreatic beta-cells in vivo improves glucose tolerance and induces beta-cell expansion via mtor activation. Diabetes 2011;60: Kimura Y, Inoue A, Hangai S, Saijo S, Negishi H, Nishio J, Yamasaki S, Iwakura Y, Yanai H, Taniguchi T: The innate immune receptor Dectin-2 mediates the phagocytosis of cancer cells by Kupffer cells for the suppression of liver metastasis. Proceedings of the National Academy of Sciences of the United States of America 2016;113: Swamydas M, Lionakis MS: Isolation, purification and labeling of mouse bone marrow neutrophils for functional studies and adoptive transfer experiments. Journal of visualized experiments : JoVE 2013:e Boxio R, Bossenmeyer-Pourie C, Steinckwich N, Dournon C, Nusse O: Mouse bone marrow contains large numbers of functionally competent neutrophils. Journal of leukocyte biology 2004;75:

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT