Supplementary Information. Mitochondrial electron transport chain and biogenesis * *
|
|
- Marcia Clark
- 6 years ago
- Views:
Transcription
1 MitoNEET-driven alterations in adipocyte mitochondrial activity reveal a crucial adaptive process that preserves insulin sensitivity in obesity Christine M. Kusminski, William L. Holland, Kai Sun, Jiyoung Park, Stephen Spurgin, Ying Lin, G Roger Askew, Judith A. Simcox, Don A. McClain, Cai Li and Philipp E. Scherer Supplementary Information ** Adiopgenesis, and FA biosynthesis Gene expression ** Mitochondrial electron transport chain and biogenesis * * Supplemental Figure 1. Adipogenesis, FA-biosynthesis and mitochondrial pathways are upregulated in. RT-PCR confirmation of key genes obtained from microarray analyses of versus (n = 9 per group).
2 a 3 25 Lipid uptake 2 3 H-triolein uptake (arbitrary units) * b gwat mwat BAT Heart Pancreas β-oxidation Soleus Lung Liver Spleen Kidney Quad Hypoth 3 H-triolein oxidation (% of total lipid uptake) * gwat mwat BAT Heart Pancreas Soleus Lung Liver Spleen Kidney Quad Hypoth c 4 Tissue mass Tissue mass (mg per g body weight) * ** gwat mwat BAT Heart Pancreas ** Soleus Lung Liver Spleen Kidney Quad Hypoth Supplemental Figure 2. MitoNEET enhances lipid-uptake and declines the rate of β-oxidation 3 specifically in. (a) H-triolein lipid-uptake, (b) β-oxidation and (c) tissue-mass in versus tissues (2 μci/mouse in 1 ul of 5% intralipid; single tail-vein injection) (n = 6 per group).
3 a AUC anova OCR (% baseline) (X1 3 ) gwat O C R (% B as eline) Oxygen- consumption rate Olig o FC C P 2-D G AA ** gwat gwat Tim e (m in) b AUC anova ECAR (mph) E CA R (m p H per m in -1 ) Glycolytic rate Olig o FC C P 2-D G AA Tim e (m in) Supplemental Figure 3. Adipose-specific overexpression of mitoneet enhances glycolysis. Oxygen consumption rates (OCRs) (top-panel) in and whole and gwat tissue-slices (~2 mg), in addition to extracellular acidification rates (ECARs) (bottom panel) (as a measure of glycolytic rate) in and tissue-slices; in response to sequential additions of oligomycin (an ATP synthase inhibitor), FCCP (a chemical uncoupler), 2-Deoxy-D-glucose (2-DG) (an inhibitor of glycolysis) and antimycin-a (complex III inhibitor) (n = 4 per group). **P <.1; P <.1.
4 a b TRE-mitoN Χ Alb-promoter Cre Rosa26 Χ LoxP MitoNEET rtta STOP β-actin LoxP 4 Χ rtta Χ TRE- promoter mitoneet MitoNEET expression relative to β -actin Rosa26 + Dox rtta TRE- promoter mitoneet c TRE-mitoN TRE-mitoN d TRE-mitoN 25 μm 25 μm OCR (pmol -1min -1) co rb As -A tim yc cc An Su e ot R Ba sa l Supplemental Figure 4. Generation of an inducible liver-specific overexpression of mitoneet. (a) Strategy of Dox-inducible overexpression of mitoneet specifically in the liver. Liver-specific albumin (Alb)-Cre mice were crossed with the Rosa26-loxP-STOP-loxP-rtTA mice to achieve liver-specific expression of rtta. These mice were then bred with TRE-mitoN transgenic mice. Following exposure to Dox, the resulting triple transgenic mice express mitoneet only in the liver. (b) Representative Western blots and the average Dox-induced overexpression of mitoneet protein in liver tissues from and TRE-MitoN mice following Dox-HFD-feeding (6 mg/kg Dox-HFD for 3-weeks) (n = 5 per group). (c) Representative H&E stain of and TRE-MitoN livers following Dox-HFD feeding. (d) OCRs in mitochondria isolated from livers and TRE-mitoN livers (n = 5 per group).
5 a Inducible mitoneet: shrna construct targeted to the Rosa26 locus D5 NeoPA H1TetO-shRNA CAGGS-iTetR Rosa26 (RMCE exchanged) b Dox - + gwat BAT Liver - + shrnamiton c MEFs shrnamiton: Primary hepatocytes p-akt Insulin: Palmitate: MnTBAP: Total-Akt Supplemental Figure 5. Generation of an inducible constitutive knockdown of mitoneet. (a) Schematic of the Dox-inducible knockdown system of mitoneet, with the shrna construct being targeted to the Rosa26 locus. (b) Representative Western blots demonstrating the Dox-induced knockdown of mitoneet protein in, gwat, BAT and liver tissues from and shrna-miton mice following Dox-chow-feeding (6 mg/kg Dox-chow for 1 d) (+Dox) or standard chow-feeding (-Dox) (n = 4 per group). (c) Representative Western blots showing insulin signaling (phospho-akt (Ser473) (p-akt) and total-akt) in Dox-treated (1 mg/ml) and shrna-miton MEFs (left panel), in addition to primary hepatocytes (right panel) derived from mice and shrna-miton mice. Expression levels were examined in response to treatments with, or without insulin, palmitate and the anti-oxidant, MnTBAP (n = 4 per group).
6 Supplemental Table 1. A summary of the differentially regulated pathways and genes identified by microarray cluster analyses from and. Gene abbreviations, definitions, in addition to fold-alterations and significant differences between and groups are indicated (n = 9 per group). *P <.5; **P <.1. Pathway Gene Gene def inition Fold-change P-value Adipogenic and lipogenic transcription factors: Pparγ Peroxisome prolif erator activated receptor γ C/ebpα/β CCAAT/enhancer-binding protein α/β Srebp1c Sterol regulatory element binding transcription f actor 1 Lxrα Nuclear receptor subf amily 1, group H, member 3 Klf15 Kruppel-like f actor 15 Adipoq Adiponectin TG synthesis, NEFA re-esterification and fatty acid biosynthesis: Lpin1 Pepck-C Dgat1/2 Glut4 Gnpat Fasn Fads1/2 Mcat Lipin 1 Phosphoenolpyruvate carboxykinase, soluble Diacylglycerol O-acyltransf erase 1 Solute carrier family 2 (facilitated glucose transporter) member 4 Glyceronephosphate O-acyltransf erase Fatty acid synthase Fatty acid desaturase 1/2 Malonyl CoA:ACP acyltransf erase Lipid-droplet associated proteins: Plin1 Perilipin 1 Fsp27 Cell death-inducing DFFA-like effector c Fatty acid uptake, transport and oxidation: Fabp5 Fatty acid binding protein 5 Fatp4 Fatty acid transporter protein 4 Cd36 Cd36 antigen Cpt1 Carnitine palmitoyl transf erase I PPARα Peroxisome prolif erator activated receptor-α / / / **.458*/.382*.5.377*.429*.187*.153*.367*.58/.342*.138*.343*.332*.42*/.443*.142*.374*.291*.297*.138*.42*.57** N.S Beta-adrenergic signaling: Adrβ1/2/3 Adrenergic receptor β 1/2/3 1.18/1.9/1.36 N.S/N.S/.16*
7 Supplemental Table 2. A list of RT-PCR primer sequences of differentially expressed genes identified by the microarray cluster analysis from derived from mice versus MitoN- Tg mice.
8 Supplemental Table 3. Ad libitum chow-fed and fasted (24 h) body-weights and serum parameters in mice versus mice (n = 7 per group). Fed Fasted (24 h) Body-weight (g) Glucose (mg/dl) Insulin (ng/ml) Triglyceride (mg/dl) FFA (mmol/l) Glycerol (mmol/l) Adiponectin (μg/ml) 28.7 ± ± ± ± ±.2.15 ± ± ± ± ± ± 8.2**.12 ±.2.16 ± ± ± ± ± ± ±.3.19 ± ± ± ± ± ± ±.4*.26 ±.2** 21.7 ±.1 Data obtained from 12-week old male FVB mice. * P <.5; ** P <.1; P <.1. Supplemental Table 4. Chow-fed ob/ob mice versus ob/ob mice fasted (3 h) bodyweights and serum parameters (n = 8 per group).
9 Supplementary Methods Animals. Generation of an inducible shrna-miton knockdown mouse model was developed as described by Seibler et al. 1 (Taconic Artemis). Briefly, the inducible shrna transgene was constructed by introduction DNA encoding an shrna of the sequence (5'- GGCCTTGCTACTGAAACATTTCAAGAGAATGTTTCAGTAGCAAGGCC-3') into a cassette consisting of a truncated Neomycin selectable marker, an H1-tetO promoter/operator for shrna expression and a CAGGS-iTetR gene (for Dox-dependent repression of shrna expression) all flanked by incompatible FRT sites for subsequent Flpe-mediated RMCE (Recombinase Mediated Cassette Exchange) 2 in ES cells. The 5' underlined 19 nucleotides are sense and the 3' underlined nucleotides are antisense to mitoneet transcripts. The shrnamiton transgene cassette was targeted to the RMCE compatible Rosa 26 locus in ES cells (strain 129S6). Six candidate shrnas were tested in this transgenic format for optimal inducible knockdown of mitoneet RNA in targeted ES cells. Targeted ES cells expressing the most potent shrna molecule were utilized for generation of mice by blastocyst injection. Mice used in the present study have been backcrossed to C57/BL6 background. To generate a Doxinducible mitoneet overexpression mouse model, mitoneet cdna and a Kozak sequence of GCCGCCACC were engineered into the ptre-tight vector (Clontech) with Xba I sites. The expression of mitoneet is controlled by 7 tandem repeats of tetracycline responsive elements in front of a minimum CMV promoter in the ptre-tight construct. A rabbit β-globin 3 UTR was included to stabilize the transcript and enhance the translation. After Nae I, and ApaL I digestion and purification, ptre-mitoneet DNA was injected to embryos into a pure C57/BL6 background by the transgenic core facility at UTSW. The liver specific albumin-cre transgenic mice and the Rosa26-loxP-STOP-loxP-rtTA transgenic mice were purchased from the Jackson
10 Laboratories. Albumin-Cre mice were firstly bred with Rosa26-loxP-STOP-loxP-rtTA mice to obtain mice homozygous for both transgenes. To achieve inducible expression of mitoneet, TRE-mitoNEET mice were then crossed with double homozygous albumin-cre and Rosa26- loxp-stop-loxp-rtta mice. The resulting triple transgenic animals were used for experiments. Age-matched transgenic animals with albumin-cre and Rosa26-loxP-STOP-loxP-rtTA genotype, but lacking the TRE-mitoNEET transgene were used as controls. Transmission electron microscope (TEM). For TEM analysis, fresh tissues were fixed by perfusion with 4% paraformaldehyde and 1% glutaraldehyde in.1 M sodium cacodylate buffer. Fixed tissues were then transferred to 2.5% glutaraldehyde in.1 M sodium cacodylate buffer, post-fixed in buffered 1% osmium tetroxide, en bloc stained in 4% uranyl acetate in 5% ethanol, dehydrated with a graded series of ethanol, then embedded in EMbed-812 resin. Thin sections were cut on a Leica Ultracut UCT ultramicrotome and post-stained with 2% uranyl acetate and lead citrate. Images were acquired on a FEI Tecnai G 2 Spirit TEM equipped with a LaB 6 source and operating at 12 kv. Primary hepatocyte isolation and treatment. Primary hepatocytes were isolated from 12-week old male C57/BL6 and shrna-miton mice. Following overnight plating, hepatocytes were treated with either palmitate (4 μm) or MnTBAP (1 mg ml -1 ) for 4 h, then acutely with insulin (16 mm) for 1 min. Protein was extracted for Western blot analysis. Mitochondrial membrane potential (ΔΨm). For ΔΨm, MEFs and shrna-miton MEFs (1x1 5 ) were incubated with or without Dox (1 μg ml -1 ; 48 h). Cells were treated with 5 μm TMRM for 2 min at 37 C, with an additional well containing control FCCP (2 μm for 3 min at 37 C). All images were obtained using a confocal microscope (Leica TCS SP5) at 63
11 magnification. In parallel, for stable transfection, the pcb7-mitoneet construct was transfected into 3T3-L1 preadipocytes using Lipofectamine 2 (Invitrogen). The transfected cells were selected by hygromycin B (125 μg ml -1 ), then individual cell clones were isolated, expanded and analyzed for expression levels of recombinant mitoneet protein by Western blot. Two clonal lines, with low- and high-mitoneet expression levels respectively, were utilized for ΔΨm analysis, along with 3T3-L1 preadipocytes pre-treated for 12 h with 1. μm TZD (rosiglitazone) or control vehicle. ΔΨm was measured using 3,3 -dihexyloxacarbocyanine iodide (DiOC 6 ; Sigma) staining. Briefly, cultured cells were washed with PBS, then incubated for 15 min at 37 C in 1 ml of serum-free culture medium containing 5 nm DiOC 6. Following centrifugation, cells were re-suspended in PBS, then immediately analyzed by flow cytometry on a FACscan (Becton Dickinson Immunocytometry Systems). References 1. Seibler, J., et al. Reversible gene knockdown in mice using a tight, inducible shrna expression system. Nucleic Acids Res 35, e54 (27). 2. Baer, A. & Bode, J. Coping with kinetic and thermodynamic barriers: RMCE, an efficient strategy for the targeted integration of transgenes. Curr Opin Biotechnol 12, (21).
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationSupporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationSupplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
More informationSupplementary Figure 1.
Supplementary Figure 1. Visualization of endoplasmic reticulum-mitochondria interaction by in situ proximity ligation assay. A) Illustration of targeted proteins in mitochondria (M), endoplasmic reticulum
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationSupplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
More informationSupplementary Information
Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationSUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
More informationApplication Note. Introduction
Simultaneously Measuring Oxidation of Exogenous and Endogenous Fatty Acids Using the XF Palmitate-BSA FAO Substrate with the Agilent Seahorse XF Cell Mito Stress Test Application Note Introduction The
More informationSupplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
More informationHIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
More informationSupplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationTargeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity
Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationSupplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:
Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments: the 5' and 3' homology recombination arms and a fragment
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationDefective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationglucose glucose 6-phospho fructose 6-phosphate fructose 1,6-bisphosphate glyceraldehyde 3-phosphate 1,3-bisphosphoglycerate 3-phosphoglycerate
Cells glucose glucose glucose 6-phospho glycogen pentose phosphate T 1-phosphate 6-phosphate gluconate CC T CC+PD-1 pathway Isobar: fructose 1,6-diphosphate; glucose 1,6-diphosphate DHAP lactate fructose
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
More informationOver-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationdoi: /nature14508 Rappsilber et al.
SUPPLEMENTARY INFORMATION doi:1.138/nature1458 Grosso et al. Barbosa et al. 74 72 45 33 47 7 51 Rappsilber et al. Supplementary Figure 1 a, Venn-Diagram of identified splice factors in the work of Barbossa
More informationUp-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice
Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice Shen Yon Toh 1,2,3., Jingyi Gong 2., Guoli Du 2., John
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationSupplementary Figure 1
Supplementary Figure 1. (A) Representative confocal analysis of cardiac mesenchymal cells from nondiabetic (ND-CMSC) and diabetic (D-CMSC) immunostained with anti-h3k9ac and anti-h3k27me3 antibodies. Analysis
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More informationSupplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
More informationab Adipogenesis Assay Kit (Cell-Based)
ab133102 Adipogenesis Assay Kit (Cell-Based) Instructions for Use For the study of induction and inhibition of adipogenesis in adherent cells. This product is for research use only and is not intended
More informationFor pair feeding, mice were fed 2.7g of HFD containing tofogliflozin
Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week
More informationFigure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
More informationGENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC
Published in "" which should be cited to refer to this work. mrna extraction and RT-PCR Total RNA from 5 15 mg of crushed white adipose tissue was isolated using the technique described by Chomczynski
More informationMcWilliams et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB McWilliams et al., http ://www.jcb.org /cgi /content /full /jcb.201603039 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. In vitro characterization of mito-qc. (A and B) Analysis
More information(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment
SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.
More informationSUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
More informationSupplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
More informationHIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury
J Mol Med 2015 HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury Sara Karsikas; Mikko Myllymäki; Minna Heikkilä; Raija Sormunen; Kari I Kivirikko; Johanna Myllyharju; Raisa
More informationSupporting Information
Supporting Information van der Windt et al. 10.1073/pnas.1221740110 SI Materials and Methods Mice and Reagents. C57BL/6 and major histocompatibility complex class I-restricted OVA-specific T-cell receptor
More informationFig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationThe autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationAdipose tissue: Roles and function in diabetes and beyond. August 2015; SAGLB.DIA
Adipose tissue: Roles and function in diabetes and beyond August 2015; SAGLB.DIA.15.07.0398 Acknowledgement The following slides intend to summarise the key points presented during the Banting Medal for
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationMouse model of human Barth syndrome
Mouse model of human Barth syndrome Zaza Khuchua, PhD Cincinnati Children s Research Foundation Cincinnati, OH, USA Barry J. Byrne, MD, PhD University of Florida Department of Pediatrics Gainesville, FL,
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationHSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)
Supplementary Figure 1. Impaired insulin action in HSP72 deficient muscle and myotubes in culture cannot be explained by altered myogenesis or reduced total GLUT4 expression. Genes associated with myogenesis
More informationMetabolic Solutions Development Company, Kalamazoo, USA.
New Insulin Sensitizers Produce Differentiation of Brown-like Adipose Cells from a Subcutaneous Fat Depot and Increase Secretion of Adiponectin in vitro William G. McDonald, Serena L. Cole, Danielle D.
More informationFH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
More informationSupplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
More informationSupporting Information
Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween
More informationSuppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes
More informationExpanded View Figures
PEX13 functions in selective autophagy Ming Y Lee et al Expanded View Figures Figure EV1. PEX13 is required for Sindbis virophagy. A, B Quantification of mcherry-capsid puncta per cell (A) and GFP-LC3
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationMuscle-specific 4E-BP1 signaling activation improves metabolic parameters during aging and obesity
Muscle-specific 4E-BP1 signaling activation improves metabolic parameters during aging and obesity Shihyin Tsai,, Albert R. La Spada, Brian K. Kennedy J Clin Invest. 2015;125(8):2952-2964. https://doi.org/10.1172/jci77361.
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationMouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)
Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer
More informationIntegration Of Metabolism
Integration Of Metabolism Metabolism Consist of Highly Interconnected Pathways The basic strategy of catabolic metabolism is to form ATP, NADPH, and building blocks for biosyntheses. 1. ATP is the universal
More informationGenerating Mouse Models of Pancreatic Cancer
Generating Mouse Models of Pancreatic Cancer Aom Isbell http://www2.massgeneral.org/cancerresourceroom/types/gi/index.asp Spring/Summer 1, 2012 Alexandros Tzatsos, MD PhD Bardeesy Lab: Goals and Objectives
More informationSUPPLEMENTARY INFORMATION
Suppl. Fig. 1 in vivo expression of ISL1 in the human fetal heart. a, Hematoxylin eosin staining showing structures of left atrium and left atrium appendage (*) of a human fetal heart at 11 weeks of gestation.
More informationACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
More informationALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/5/213/213ra164/dc1 Supplementary Materials for HIV-1 Vpr Induces Adipose Dysfunction in Vivo Through Reciprocal Effects on PPAR/GR Co-Regulation Neeti
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationSupplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationSUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
More information1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
More information